EMAIL THIS PAGE TO A FRIEND

GM2A

GM2 ganglioside activator

81 Gene Product Result for
Synonyms: GM2-AP SAP-3
UniProtKB ID: P17900, B2R699, D3DQH6, Q14426, Q14428, Q6LBL5
Gene ID:
Human(2760) Summary: This gene encodes a small glycolipid transport protein which acts as a substrate specific co-factor for the lysosomal enzyme beta-hexosaminidase A. Beta-hexosaminidase A, together with GM2 ganglioside activator, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Mutations in this gene result in GM2-gangliosidosis type AB or the AB variant of Tay-Sachs disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
Mouse(14667) GM2 ganglioside activator protein
Rat(282838) GM2 ganglioside activator
sheep(101105496) GM2 ganglioside activator
domestic guinea pig(100731438) GM2 ganglioside activator
naked mole-rat(101706300) GM2 ganglioside activator
Zebrafish(550529) GM2 ganglioside activator
chicken(100857973) GM2 ganglioside activator
domestic cat(100174922) GM2 ganglioside activator
cow(504524) GM2 ganglioside activator
Horse(100034082) GM2 ganglioside activator
dog(479324) GM2 ganglioside activator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000405 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010299 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010299 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010299 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000405 Rosetta Predictions human pricing
NM_172335 Rosetta Predictions rat pricing
NM_010299 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054802 predicted 500
2 SASI_Hs01_00054803 predicted 461
3 SASI_Hs01_00054804 predicted 469
4 SASI_Hs01_00054805 predicted 727
5 SASI_Hs01_00054806 predicted 588
6 SASI_Hs01_00054807 predicted 711
7 SASI_Hs01_00054808 predicted 604
8 SASI_Hs01_00054809 predicted 572
9 SASI_Hs01_00054810 predicted 593
10 SASI_Hs01_00054811 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048894 predicted 721
2 SASI_Rn01_00048895 predicted 889
3 SASI_Rn01_00048897 predicted 839
4 SASI_Rn02_00269227 predicted 864
5 SASI_Rn01_00048898 predicted 1024
6 SASI_Rn01_00048899 predicted 735
7 SASI_Rn01_00048900 predicted 1076
8 SASI_Rn01_00048903 predicted 1001
9 SASI_Rn02_00269228 predicted 467
10 SASI_Rn02_00269229 predicted 369
11 SASI_Rn01_00048896 predicted 1016
12 SASI_Rn01_00048901 predicted 383
13 SASI_Rn01_00048902 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029790 predicted 867
2 SASI_Mm01_00029791 predicted 1041
3 SASI_Mm01_00029793 predicted 320
4 SASI_Mm02_00318269 predicted 774
5 SASI_Mm02_00318270 predicted 371
6 SASI_Mm01_00029796 predicted 374
7 SASI_Mm01_00029797 predicted 380
8 SASI_Mm01_00029798 predicted 1043
9 SASI_Mm01_00029799 predicted 865
10 SASI_Mm02_00318271 predicted 875
11 SASI_Mm01_00029792 predicted 977
12 SASI_Mm01_00029794 predicted 831
13 SASI_Mm01_00029795 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000405
VALIDATED
GM2A MISSION shRNA Bacterial Glycerol Stock
GM2 ganglioside activator
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000405.4-268s21c1
Sequence:CCGGTCCTGGGATAACTGTGATGAACTCGAGTTCATCACAGTTATCCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000405.4-581s21c1
Sequence:CCGGCCTTCAAAGAAGGAACCTACTCTCGAGAGTAGGTTCCTTCTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000405.4-725s21c1
Sequence:CCGGCTGCCTCTCTAAAGGGCATATCTCGAGATATGCCCTTTAGAGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000405.4-453s21c1
Sequence:CCGGGATCCCATGCACAGACTACATCTCGAGATGTAGTCTGTGCATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000405.3-1195s1c1
Sequence:CCGGCCTTAACTTCTGTGACTAATTCTCGAGAATTAGTCACAGAAGTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000405.3-550s1c1
Sequence:CCGGCCTTCAAAGAAGGAACCTACTCTCGAGAGTAGGTTCCTTCTTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000405.3-694s1c1
Sequence:CCGGCTGCCTCTCTAAAGGGCATATCTCGAGATATGCCCTTTAGAGAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000405.3-422s1c1
Sequence:CCGGGATCCCATGCACAGACTACATCTCGAGATGTAGTCTGTGCATGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000405.3-237s1c1
Sequence:CCGGTCCTGGGATAACTGTGATGAACTCGAGTTCATCACAGTTATCCCAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000405
VALIDATED
GM2A MISSION shRNA shRNA Plasmid DNA
GM2 ganglioside activator
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000405.4-268s21c1
Sequence:CCGGTCCTGGGATAACTGTGATGAACTCGAGTTCATCACAGTTATCCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000405.4-581s21c1
Sequence:CCGGCCTTCAAAGAAGGAACCTACTCTCGAGAGTAGGTTCCTTCTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000405.4-725s21c1
Sequence:CCGGCTGCCTCTCTAAAGGGCATATCTCGAGATATGCCCTTTAGAGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000405.4-453s21c1
Sequence:CCGGGATCCCATGCACAGACTACATCTCGAGATGTAGTCTGTGCATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000405.3-1195s1c1
Sequence:CCGGCCTTAACTTCTGTGACTAATTCTCGAGAATTAGTCACAGAAGTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000405.3-550s1c1
Sequence:CCGGCCTTCAAAGAAGGAACCTACTCTCGAGAGTAGGTTCCTTCTTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000405.3-694s1c1
Sequence:CCGGCTGCCTCTCTAAAGGGCATATCTCGAGATATGCCCTTTAGAGAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000405.3-422s1c1
Sequence:CCGGGATCCCATGCACAGACTACATCTCGAGATGTAGTCTGTGCATGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000405.3-237s1c1
Sequence:CCGGTCCTGGGATAACTGTGATGAACTCGAGTTCATCACAGTTATCCCAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000405
VALIDATED
GM2A MISSION shRNA Lentiviral Transduction Particles
GM2 ganglioside activator
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000405.4-268s21c1
Sequence:CCGGTCCTGGGATAACTGTGATGAACTCGAGTTCATCACAGTTATCCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000405.4-581s21c1
Sequence:CCGGCCTTCAAAGAAGGAACCTACTCTCGAGAGTAGGTTCCTTCTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000405.4-725s21c1
Sequence:CCGGCTGCCTCTCTAAAGGGCATATCTCGAGATATGCCCTTTAGAGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000405.4-453s21c1
Sequence:CCGGGATCCCATGCACAGACTACATCTCGAGATGTAGTCTGTGCATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000405.3-1195s1c1
Sequence:CCGGCCTTAACTTCTGTGACTAATTCTCGAGAATTAGTCACAGAAGTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000405.3-550s1c1
Sequence:CCGGCCTTCAAAGAAGGAACCTACTCTCGAGAGTAGGTTCCTTCTTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000405.3-694s1c1
Sequence:CCGGCTGCCTCTCTAAAGGGCATATCTCGAGATATGCCCTTTAGAGAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000405.3-422s1c1
Sequence:CCGGGATCCCATGCACAGACTACATCTCGAGATGTAGTCTGTGCATGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000405.3-237s1c1
Sequence:CCGGTCCTGGGATAACTGTGATGAACTCGAGTTCATCACAGTTATCCCAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010299
VALIDATED
GM2A MISSION shRNA Bacterial Glycerol Stock
GM2 ganglioside activator
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010299.2-550s21c1
Sequence:CCGGACCGCATCCAGAGTATCTTGACTCGAGTCAAGATACTCTGGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010299.2-381s21c1
Sequence:CCGGTGTGACCTGATAGACGAATACCTCGAGGTATTCGTCTATCAGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010299.2-1049s21c1
Sequence:CCGGAGTCTTGGGTCCCTCTATTAACTCGAGTTAATAGAGGGACCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010299.2-319s21c1
Sequence:CCGGCTGGCTTCTGGGTCAAGATTCCTCGAGGAATCTTGACCCAGAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010299.2-384s1c1
Sequence:CCGGGACCTGATAGACGAATACATTCTCGAGAATGTATTCGTCTATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010299.2-609s21c1
Sequence:CCGGGCCTCTCTCAAGGGCAGATAACTCGAGTTATCTGCCCTTGAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010299.2-361s1c1
Sequence:CCGGGCTGTAGCTACGAGAACATCTCTCGAGAGATGTTCTCGTAGCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010299
VALIDATED
GM2A MISSION shRNA shRNA Plasmid DNA
GM2 ganglioside activator
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010299.2-550s21c1
Sequence:CCGGACCGCATCCAGAGTATCTTGACTCGAGTCAAGATACTCTGGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010299.2-381s21c1
Sequence:CCGGTGTGACCTGATAGACGAATACCTCGAGGTATTCGTCTATCAGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010299.2-1049s21c1
Sequence:CCGGAGTCTTGGGTCCCTCTATTAACTCGAGTTAATAGAGGGACCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010299.2-319s21c1
Sequence:CCGGCTGGCTTCTGGGTCAAGATTCCTCGAGGAATCTTGACCCAGAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010299.2-384s1c1
Sequence:CCGGGACCTGATAGACGAATACATTCTCGAGAATGTATTCGTCTATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010299.2-609s21c1
Sequence:CCGGGCCTCTCTCAAGGGCAGATAACTCGAGTTATCTGCCCTTGAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010299.2-361s1c1
Sequence:CCGGGCTGTAGCTACGAGAACATCTCTCGAGAGATGTTCTCGTAGCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010299
VALIDATED
GM2A MISSION shRNA Lentiviral Transduction Particles
GM2 ganglioside activator
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010299.2-550s21c1
Sequence:CCGGACCGCATCCAGAGTATCTTGACTCGAGTCAAGATACTCTGGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010299.2-381s21c1
Sequence:CCGGTGTGACCTGATAGACGAATACCTCGAGGTATTCGTCTATCAGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010299.2-1049s21c1
Sequence:CCGGAGTCTTGGGTCCCTCTATTAACTCGAGTTAATAGAGGGACCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010299.2-319s21c1
Sequence:CCGGCTGGCTTCTGGGTCAAGATTCCTCGAGGAATCTTGACCCAGAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010299.2-384s1c1
Sequence:CCGGGACCTGATAGACGAATACATTCTCGAGAATGTATTCGTCTATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010299.2-609s21c1
Sequence:CCGGGCCTCTCTCAAGGGCAGATAACTCGAGTTATCTGCCCTTGAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010299.2-361s1c1
Sequence:CCGGGCTGTAGCTACGAGAACATCTCTCGAGAGATGTTCTCGTAGCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks