EMAIL THIS PAGE TO A FRIEND

GMCL1

germ cell-less, spermatogenesis associated 1

99 Gene Product Result for
Synonyms: BTBD13 GCL GCL1 SPATA29
UniProtKB ID: Q96IK5, Q9H826, Q9H8V7, Q9H927
Gene ID:
Human(64395) Summary: This gene encodes a nuclear envelope protein that appears to be involved in spermatogenesis, either directly or by influencing genes that play a more direct role in the process. This multi-exon locus is the homolog of the mouse and drosophila germ cell-less gene but the human genome also contains a single-exon locus on chromosome 5 that contains an open reading frame capable of encoding a highly-related protein. [provided by RefSeq, Jul 2008]
Mouse(23885) germ cell-less homolog 1 (Drosophila)
Rat(312516) germ cell-less, spermatogenesis associated 1
Zebrafish(322146) germ cell-less homolog 1 (Drosophila)
cow(513934) germ cell-less, spermatogenesis associated 1
domestic cat(101094665) germ cell-less, spermatogenesis associated 1
dog(481414) germ cell-less, spermatogenesis associated 1
chicken(426327) germ cell-less homolog 1 (Drosophila)
domestic guinea pig(100719411) germ cell-less, spermatogenesis associated 1
naked mole-rat(101698617) germ cell-less, spermatogenesis associated 1
sheep(101115868) germ cell-less, spermatogenesis associated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178439 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011818 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011818 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011818 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178439 Rosetta Predictions human pricing
NM_001010956 Rosetta Predictions rat pricing
NM_001033931 Rosetta Predictions rat pricing
NM_011818 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183683 predicted 1362
2 SASI_Hs01_00183684 predicted 555
3 SASI_Hs01_00183682 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054491 predicted 1156
2 SASI_Rn01_00054492 predicted 871
3 SASI_Rn01_00054493 predicted 1175
4 SASI_Rn01_00054495 predicted 712
5 SASI_Rn02_00199830 predicted 532
6 SASI_Rn01_00054496 predicted 475
7 SASI_Rn01_00054497 predicted 1131
8 SASI_Rn01_00054498 predicted 616
9 SASI_Rn02_00199831 predicted 532
10 SASI_Rn01_00054500 predicted 977
11 SASI_Rn01_00054494 predicted 969
12 SASI_Rn01_00054499 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033931 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095887 predicted 1153
2 SASI_Rn01_00095888 predicted 872
3 SASI_Rn01_00095889 predicted 1177
4 SASI_Rn01_00095891 predicted 704
5 SASI_Rn02_00203831 predicted 536
6 SASI_Rn01_00095892 predicted 477
7 SASI_Rn01_00095893 predicted 1135
8 SASI_Rn01_00095894 predicted 621
9 SASI_Rn02_00203832 predicted 524
10 SASI_Rn01_00095896 predicted 983
11 SASI_Rn01_00095890 predicted 969
12 SASI_Rn01_00095895 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057752 predicted 1513
2 SASI_Mm01_00057753 predicted 1664
3 SASI_Mm02_00321518 predicted 1624
4 SASI_Mm01_00057754 predicted 1179
5 SASI_Mm01_00057755 predicted 1456
6 SASI_Mm01_00057756 predicted 1604
7 SASI_Mm01_00057758 predicted 660
8 SASI_Mm01_00057759 predicted 1199
9 SASI_Mm01_00057760 predicted 1141
10 SASI_Mm02_00321519 predicted 1790
11 SASI_Mm01_00057751 predicted 1135
12 SASI_Mm01_00057757 predicted 1003
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178439
VALIDATED
GMCL1 MISSION shRNA Bacterial Glycerol Stock
germ cell-less, spermatogenesis associated 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-1689s21c1
Sequence:CCGGGCTTCTGATCTTCCCTTTATACTCGAGTATAAAGGGAAGATCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-1026s21c1
Sequence:CCGGGGATATATACACTGCTCTAAACTCGAGTTTAGAGCAGTGTATATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-862s21c1
Sequence:CCGGTCAGCAGGGACCTATGGATTACTCGAGTAATCCATAGGTCCCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-1854s21c1
Sequence:CCGGCCTACTGATATTCACATCGAACTCGAGTTCGATGTGAATATCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-775s21c1
Sequence:CCGGTTGCTGCAGTTGGACGGTTTACTCGAGTAAACCGTCCAACTGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-1407s1c1
Sequence:CCGGGCTTGCCAAAGATGGTGAATACTCGAGTATTCACCATCTTTGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134876    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178439.3-1896s1c1
Sequence:CCGGCCTTATGAACTGTACAGACAACTCGAGTTGTCTGTACAGTTCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-1689s1c1
Sequence:CCGGGCTTCTGATCTTCCCTTTATACTCGAGTATAAAGGGAAGATCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-1156s1c1
Sequence:CCGGGCCTTTCTTGAAACTGAACAACTCGAGTTGTTCAGTTTCAAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178439.3-667s1c1
Sequence:CCGGGACCAGAACATTGATGTAGAACTCGAGTTCTACATCAATGTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-664s1c1
Sequence:CCGGCCTGACCAGAACATTGATGTACTCGAGTACATCAATGTTCTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-1854s1c1
Sequence:CCGGCCTACTGATATTCACATCGAACTCGAGTTCGATGTGAATATCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178439
VALIDATED
GMCL1 MISSION shRNA shRNA Plasmid DNA
germ cell-less, spermatogenesis associated 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-1689s21c1
Sequence:CCGGGCTTCTGATCTTCCCTTTATACTCGAGTATAAAGGGAAGATCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-1026s21c1
Sequence:CCGGGGATATATACACTGCTCTAAACTCGAGTTTAGAGCAGTGTATATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-862s21c1
Sequence:CCGGTCAGCAGGGACCTATGGATTACTCGAGTAATCCATAGGTCCCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-1854s21c1
Sequence:CCGGCCTACTGATATTCACATCGAACTCGAGTTCGATGTGAATATCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-775s21c1
Sequence:CCGGTTGCTGCAGTTGGACGGTTTACTCGAGTAAACCGTCCAACTGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-1407s1c1
Sequence:CCGGGCTTGCCAAAGATGGTGAATACTCGAGTATTCACCATCTTTGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134876    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178439.3-1896s1c1
Sequence:CCGGCCTTATGAACTGTACAGACAACTCGAGTTGTCTGTACAGTTCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-1689s1c1
Sequence:CCGGGCTTCTGATCTTCCCTTTATACTCGAGTATAAAGGGAAGATCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-1156s1c1
Sequence:CCGGGCCTTTCTTGAAACTGAACAACTCGAGTTGTTCAGTTTCAAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178439.3-667s1c1
Sequence:CCGGGACCAGAACATTGATGTAGAACTCGAGTTCTACATCAATGTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-664s1c1
Sequence:CCGGCCTGACCAGAACATTGATGTACTCGAGTACATCAATGTTCTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-1854s1c1
Sequence:CCGGCCTACTGATATTCACATCGAACTCGAGTTCGATGTGAATATCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178439
VALIDATED
GMCL1 MISSION shRNA Lentiviral Transduction Particles
germ cell-less, spermatogenesis associated 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-1689s21c1
Sequence:CCGGGCTTCTGATCTTCCCTTTATACTCGAGTATAAAGGGAAGATCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-1026s21c1
Sequence:CCGGGGATATATACACTGCTCTAAACTCGAGTTTAGAGCAGTGTATATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-862s21c1
Sequence:CCGGTCAGCAGGGACCTATGGATTACTCGAGTAATCCATAGGTCCCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-1854s21c1
Sequence:CCGGCCTACTGATATTCACATCGAACTCGAGTTCGATGTGAATATCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_178439.3-775s21c1
Sequence:CCGGTTGCTGCAGTTGGACGGTTTACTCGAGTAAACCGTCCAACTGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-1407s1c1
Sequence:CCGGGCTTGCCAAAGATGGTGAATACTCGAGTATTCACCATCTTTGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134876    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178439.3-1896s1c1
Sequence:CCGGCCTTATGAACTGTACAGACAACTCGAGTTGTCTGTACAGTTCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-1689s1c1
Sequence:CCGGGCTTCTGATCTTCCCTTTATACTCGAGTATAAAGGGAAGATCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-1156s1c1
Sequence:CCGGGCCTTTCTTGAAACTGAACAACTCGAGTTGTTCAGTTTCAAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178439.3-667s1c1
Sequence:CCGGGACCAGAACATTGATGTAGAACTCGAGTTCTACATCAATGTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-664s1c1
Sequence:CCGGCCTGACCAGAACATTGATGTACTCGAGTACATCAATGTTCTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_178439.3-1854s1c1
Sequence:CCGGCCTACTGATATTCACATCGAACTCGAGTTCGATGTGAATATCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011818
VALIDATED
GMCL1 MISSION shRNA Bacterial Glycerol Stock
germ cell-less, spermatogenesis associated 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011818.3-714s21c1
Sequence:CCGGTGTATCGAGATGACGTCTTAACTCGAGTTAAGACGTCATCTCGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011818.3-1551s21c1
Sequence:CCGGCTCGAAGGAGCATAGCATTTACTCGAGTAAATGCTATGCTCCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011818.3-1551s1c1
Sequence:CCGGCTCGAAGGAGCATAGCATTTACTCGAGTAAATGCTATGCTCCTTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011818.3-1479s21c1
Sequence:CCGGACACCAATCGATACATCATTTCTCGAGAAATGATGTATCGATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011818.3-987s21c1
Sequence:CCGGTCATTGGTTCGTCTAACTTATCTCGAGATAAGTTAGACGAACCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011818.3-2132s21c1
Sequence:CCGGGAATGCTAAGGACGGAGTTTACTCGAGTAAACTCCGTCCTTAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011818.2-850s1c1
Sequence:CCGGCTATGGACTAGACTCTGTAAACTCGAGTTTACAGAGTCTAGTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011818.2-2146s1c1
Sequence:CCGGGCTCTTTCAATTGGTGCCTTTCTCGAGAAAGGCACCAATTGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011818
VALIDATED
GMCL1 MISSION shRNA shRNA Plasmid DNA
germ cell-less, spermatogenesis associated 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011818.3-714s21c1
Sequence:CCGGTGTATCGAGATGACGTCTTAACTCGAGTTAAGACGTCATCTCGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011818.3-1551s21c1
Sequence:CCGGCTCGAAGGAGCATAGCATTTACTCGAGTAAATGCTATGCTCCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011818.3-1551s1c1
Sequence:CCGGCTCGAAGGAGCATAGCATTTACTCGAGTAAATGCTATGCTCCTTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011818.3-1479s21c1
Sequence:CCGGACACCAATCGATACATCATTTCTCGAGAAATGATGTATCGATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011818.3-987s21c1
Sequence:CCGGTCATTGGTTCGTCTAACTTATCTCGAGATAAGTTAGACGAACCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011818.3-2132s21c1
Sequence:CCGGGAATGCTAAGGACGGAGTTTACTCGAGTAAACTCCGTCCTTAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011818.2-850s1c1
Sequence:CCGGCTATGGACTAGACTCTGTAAACTCGAGTTTACAGAGTCTAGTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011818.2-2146s1c1
Sequence:CCGGGCTCTTTCAATTGGTGCCTTTCTCGAGAAAGGCACCAATTGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011818
VALIDATED
GMCL1 MISSION shRNA Lentiviral Transduction Particles
germ cell-less, spermatogenesis associated 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011818.3-714s21c1
Sequence:CCGGTGTATCGAGATGACGTCTTAACTCGAGTTAAGACGTCATCTCGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011818.3-1551s21c1
Sequence:CCGGCTCGAAGGAGCATAGCATTTACTCGAGTAAATGCTATGCTCCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011818.3-1551s1c1
Sequence:CCGGCTCGAAGGAGCATAGCATTTACTCGAGTAAATGCTATGCTCCTTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011818.3-1479s21c1
Sequence:CCGGACACCAATCGATACATCATTTCTCGAGAAATGATGTATCGATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011818.3-987s21c1
Sequence:CCGGTCATTGGTTCGTCTAACTTATCTCGAGATAAGTTAGACGAACCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011818.3-2132s21c1
Sequence:CCGGGAATGCTAAGGACGGAGTTTACTCGAGTAAACTCCGTCCTTAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011818.2-850s1c1
Sequence:CCGGCTATGGACTAGACTCTGTAAACTCGAGTTTACAGAGTCTAGTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011818.2-2146s1c1
Sequence:CCGGGCTCTTTCAATTGGTGCCTTTCTCGAGAAAGGCACCAATTGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks