EMAIL THIS PAGE TO A FRIEND

GMCL1P1

germ cell-less, spermatogenesis associated 1 pseudogene 1

100 Gene Product Result for
Synonyms: GCL GMCL1L GMCL2
Species: Human GMCL1P1(64396)
UniProtKB ID: Q8NEA9, B2RDW6, Q8TC88, Q8TC89
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407880 Anti-GMCL1L antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022471 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022471 Rosetta Predictions human pricing
NR_003281 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233661 predicted 946
2 SASI_Hs01_00233662 predicted 787
3 SASI_Hs01_00233663 predicted 1180
4 SASI_Hs01_00233664 predicted 475
5 SASI_Hs01_00233665 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379087 predicted 2271
2 SASI_Hs02_00379088 predicted 946
3 SASI_Hs02_00379089 predicted 1188
4 SASI_Hs02_00379090 predicted 2275
5 SASI_Hs02_00379091 predicted 479
6 SASI_Hs02_00379092 predicted 785
7 SASI_Hs02_00379093 predicted 950
8 SASI_Hs02_00379094 predicted 2640
9 SASI_Hs02_00379095 predicted 2637
10 SASI_Hs02_00379096 predicted 1913
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022471
GMCL1P1 MISSION shRNA Bacterial Glycerol Stock
germ cell-less, spermatogenesis associated 1 pseudogene 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022471.2-468s1c1
Sequence:CCGGCTCTAGGAGAAGAATGGCGATCTCGAGATCGCCATTCTTCTCCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-660s1c1
Sequence:CCGGCCAGTCGAGTTGTTGCCATTTCTCGAGAAATGGCAACAACTCGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022471.2-1828s1c1
Sequence:CCGGCGGACAATACAGAAGACTATTCTCGAGAATAGTCTTCTGTATTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022471.2-2415s1c1
Sequence:CCGGCCAGGGATATTTCTTGTCTTACTCGAGTAAGACAAGAAATATCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150681    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022471.2-2187s1c1
Sequence:CCGGGCTCATTATGATTCCTCCTTTCTCGAGAAAGGAGGAATCATAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-1473s1c1
Sequence:CCGGGAAGGAGCATAGCATTTAGATCTCGAGATCTAAATGCTATGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022471.2-1771s1c1
Sequence:CCGGCCCTACTGATATTCACATCTACTCGAGTAGATGTGAATATCAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-992s1c1
Sequence:CCGGCCTTCTTGGAATGGATCTTTACTCGAGTAAAGATCCATTCCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-1327s1c1
Sequence:CCGGGCTTGCCAAAGATGGTGAATACTCGAGTATTCACCATCTTTGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-584s1c1
Sequence:CCGGCCTGACCAGAACATTGATGTACTCGAGTACATCAATGTTCTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-1247s1c1
Sequence:CCGGGCAGAACAAGACCATGAGGTACTCGAGTACCTCATGGTCTTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022471
GMCL1P1 MISSION shRNA shRNA Plasmid DNA
germ cell-less, spermatogenesis associated 1 pseudogene 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022471.2-468s1c1
Sequence:CCGGCTCTAGGAGAAGAATGGCGATCTCGAGATCGCCATTCTTCTCCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-660s1c1
Sequence:CCGGCCAGTCGAGTTGTTGCCATTTCTCGAGAAATGGCAACAACTCGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022471.2-1828s1c1
Sequence:CCGGCGGACAATACAGAAGACTATTCTCGAGAATAGTCTTCTGTATTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022471.2-2415s1c1
Sequence:CCGGCCAGGGATATTTCTTGTCTTACTCGAGTAAGACAAGAAATATCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150681    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022471.2-2187s1c1
Sequence:CCGGGCTCATTATGATTCCTCCTTTCTCGAGAAAGGAGGAATCATAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-1473s1c1
Sequence:CCGGGAAGGAGCATAGCATTTAGATCTCGAGATCTAAATGCTATGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022471.2-1771s1c1
Sequence:CCGGCCCTACTGATATTCACATCTACTCGAGTAGATGTGAATATCAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-992s1c1
Sequence:CCGGCCTTCTTGGAATGGATCTTTACTCGAGTAAAGATCCATTCCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-1327s1c1
Sequence:CCGGGCTTGCCAAAGATGGTGAATACTCGAGTATTCACCATCTTTGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-584s1c1
Sequence:CCGGCCTGACCAGAACATTGATGTACTCGAGTACATCAATGTTCTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-1247s1c1
Sequence:CCGGGCAGAACAAGACCATGAGGTACTCGAGTACCTCATGGTCTTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022471
GMCL1P1 MISSION shRNA Lentiviral Transduction Particles
germ cell-less, spermatogenesis associated 1 pseudogene 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022471.2-468s1c1
Sequence:CCGGCTCTAGGAGAAGAATGGCGATCTCGAGATCGCCATTCTTCTCCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-660s1c1
Sequence:CCGGCCAGTCGAGTTGTTGCCATTTCTCGAGAAATGGCAACAACTCGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022471.2-1828s1c1
Sequence:CCGGCGGACAATACAGAAGACTATTCTCGAGAATAGTCTTCTGTATTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022471.2-2415s1c1
Sequence:CCGGCCAGGGATATTTCTTGTCTTACTCGAGTAAGACAAGAAATATCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150681    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022471.2-2187s1c1
Sequence:CCGGGCTCATTATGATTCCTCCTTTCTCGAGAAAGGAGGAATCATAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-1473s1c1
Sequence:CCGGGAAGGAGCATAGCATTTAGATCTCGAGATCTAAATGCTATGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022471.2-1771s1c1
Sequence:CCGGCCCTACTGATATTCACATCTACTCGAGTAGATGTGAATATCAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-992s1c1
Sequence:CCGGCCTTCTTGGAATGGATCTTTACTCGAGTAAAGATCCATTCCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-1327s1c1
Sequence:CCGGGCTTGCCAAAGATGGTGAATACTCGAGTATTCACCATCTTTGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-584s1c1
Sequence:CCGGCCTGACCAGAACATTGATGTACTCGAGTACATCAATGTTCTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022471.2-1247s1c1
Sequence:CCGGGCAGAACAAGACCATGAGGTACTCGAGTACCTCATGGTCTTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks