EMAIL THIS PAGE TO A FRIEND

GMDS

GDP-mannose 4,6-dehydratase

53 Gene Product Result for
Synonyms: GMD SDR3E1
Gene ID:
Human(2762) Summary: GDP-mannose 4,6-dehydratase (GMD; EC 4.2.1.47) catalyzes the conversion of GDP-mannose to GDP-4-keto-6-deoxymannose, the first step in the synthesis of GDP-fucose from GDP-mannose, using NADP+ as a cofactor. The second and third steps of the pathway are catalyzed by a single enzyme, GDP-keto-6-deoxymannose 3,5-epimerase, 4-reductase, designated FX in humans (MIM 137020).[supplied by OMIM, Aug 2009]
Mouse(218138) GDP-mannose 4, 6-dehydratase
Rat(291095) GDP-mannose 4, 6-dehydratase
Zebrafish(393461) GDP-mannose 4,6-dehydratase
cow(617688) GDP-mannose 4,6-dehydratase
Horse(100057325) GDP-mannose 4,6-dehydratase
domestic cat(101086651) GDP-mannose 4,6-dehydratase
dog(488189) GDP-mannose 4,6-dehydratase
chicken(420890) GDP-mannose 4,6-dehydratase
sheep(101101931) GDP-mannose 4,6-dehydratase
naked mole-rat(101703718) GDP-mannose 4,6-dehydratase
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146041 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146041 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146041 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001500 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001500 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001500 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047091 MISSION® esiRNA esiRNA human GMDS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001500 Rosetta Predictions human pricing
NM_001039606 Rosetta Predictions rat pricing
NM_146041 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170679 predicted 956
2 SASI_Hs01_00170680 predicted 644
3 SASI_Hs01_00170681 predicted 871
4 SASI_Hs01_00170683 predicted 589
5 SASI_Hs01_00170684 predicted 578
6 SASI_Hs01_00170685 predicted 429
7 SASI_Hs02_00331991 predicted 610
8 SASI_Hs01_00170686 predicted 535
9 SASI_Hs02_00331992 predicted 477
10 SASI_Hs01_00170687 predicted 403
11 SASI_Hs01_00170682 predicted 452
12 SASI_Hs01_00170688 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059304 predicted 206
2 SASI_Rn01_00059305 predicted 943
3 SASI_Rn01_00059306 predicted 719
4 SASI_Rn01_00059307 predicted 244
5 SASI_Rn02_00204858 predicted 996
6 SASI_Rn02_00204859 predicted 478
7 SASI_Rn01_00059308 predicted 618
8 SASI_Rn01_00059309 predicted 562
9 SASI_Rn01_00059310 predicted 784
10 SASI_Rn01_00059312 predicted 223
11 SASI_Rn01_00059311 predicted 635
12 SASI_Rn01_00059313 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054886 predicted 245
2 SASI_Mm01_00054887 predicted 284
3 SASI_Mm01_00054889 predicted 918
4 SASI_Mm01_00054890 predicted 658
5 SASI_Mm01_00054892 predicted 213
6 SASI_Mm01_00054893 predicted 209
7 SASI_Mm02_00341645 predicted 741
8 SASI_Mm01_00054894 predicted 912
9 SASI_Mm01_00054895 predicted 980
10 SASI_Mm02_00341646 predicted 515
11 SASI_Mm01_00054888 predicted 250
12 SASI_Mm01_00054891 predicted 252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146041
GMDS MISSION shRNA Bacterial Glycerol Stock
GDP-mannose 4,6-dehydratase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146041.1-1374s1c1
Sequence:CCGGCTCTGACTGGTTTCAGGAAATCTCGAGATTTCCTGAAACCAGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146041.1-602s1c1
Sequence:CCGGGCAGCCAAACTCTATGCCTATCTCGAGATAGGCATAGAGTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146041.1-461s1c1
Sequence:CCGGCGGCTTCTGGATGCAATTAAACTCGAGTTTAATTGCATCCAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146041.1-489s1c1
Sequence:CCGGGCCTTATAAATTCTGTGAAGTCTCGAGACTTCACAGAATTTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146041.1-224s1c1
Sequence:CCGGCGGCGATCTAGTTCATTTAATCTCGAGATTAAATGAACTAGATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146041.2-363s21c1
Sequence:CCGGAGCCTACAGAGATCTATAATCCTCGAGGATTATAGATCTCTGTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146041.2-270s21c1
Sequence:CCGGAGAATCCTCAGGCTCATATTGCTCGAGCAATATGAGCCTGAGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146041.2-972s21c1
Sequence:CCGGATGAAGTGGGCAGATGTAAAGCTCGAGCTTTACATCTGCCCACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146041
GMDS MISSION shRNA shRNA Plasmid DNA
GDP-mannose 4,6-dehydratase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146041.1-1374s1c1
Sequence:CCGGCTCTGACTGGTTTCAGGAAATCTCGAGATTTCCTGAAACCAGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146041.1-602s1c1
Sequence:CCGGGCAGCCAAACTCTATGCCTATCTCGAGATAGGCATAGAGTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146041.1-461s1c1
Sequence:CCGGCGGCTTCTGGATGCAATTAAACTCGAGTTTAATTGCATCCAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146041.1-489s1c1
Sequence:CCGGGCCTTATAAATTCTGTGAAGTCTCGAGACTTCACAGAATTTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146041.1-224s1c1
Sequence:CCGGCGGCGATCTAGTTCATTTAATCTCGAGATTAAATGAACTAGATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146041.2-363s21c1
Sequence:CCGGAGCCTACAGAGATCTATAATCCTCGAGGATTATAGATCTCTGTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146041.2-270s21c1
Sequence:CCGGAGAATCCTCAGGCTCATATTGCTCGAGCAATATGAGCCTGAGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146041.2-972s21c1
Sequence:CCGGATGAAGTGGGCAGATGTAAAGCTCGAGCTTTACATCTGCCCACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146041
GMDS MISSION shRNA Lentiviral Transduction Particles
GDP-mannose 4,6-dehydratase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146041.1-1374s1c1
Sequence:CCGGCTCTGACTGGTTTCAGGAAATCTCGAGATTTCCTGAAACCAGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146041.1-602s1c1
Sequence:CCGGGCAGCCAAACTCTATGCCTATCTCGAGATAGGCATAGAGTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146041.1-461s1c1
Sequence:CCGGCGGCTTCTGGATGCAATTAAACTCGAGTTTAATTGCATCCAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146041.1-489s1c1
Sequence:CCGGGCCTTATAAATTCTGTGAAGTCTCGAGACTTCACAGAATTTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146041.1-224s1c1
Sequence:CCGGCGGCGATCTAGTTCATTTAATCTCGAGATTAAATGAACTAGATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146041.2-363s21c1
Sequence:CCGGAGCCTACAGAGATCTATAATCCTCGAGGATTATAGATCTCTGTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146041.2-270s21c1
Sequence:CCGGAGAATCCTCAGGCTCATATTGCTCGAGCAATATGAGCCTGAGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146041.2-972s21c1
Sequence:CCGGATGAAGTGGGCAGATGTAAAGCTCGAGCTTTACATCTGCCCACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001500
VALIDATED
GMDS MISSION shRNA Bacterial Glycerol Stock
GDP-mannose 4,6-dehydratase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001500.2-462s1c1
Sequence:CCGGCCTGCCTTGTGAAGATCATTACTCGAGTAATGATCTTCACAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001500.2-363s1c1
Sequence:CCGGGTTCATTTAATACGGGTCGAACTCGAGTTCGACCCGTATTAAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001500.2-861s1c1
Sequence:CCGGGCCGGTCAGTAGCTAAGATTTCTCGAGAAATCTTAGCTACTGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001500.2-770s1c1
Sequence:CCGGCGTGAGGCGTATAATCTCTTTCTCGAGAAAGAGATTATACGCCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001500.2-1045s1c1
Sequence:CCGGCGAGAAATCATTCTTGCACATCTCGAGATGTGCAAGAATGATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001500.2-824s21c1
Sequence:CCGGCCCAGAAGAGGAGCTAATTTCCTCGAGGAAATTAGCTCCTCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001500.2-1523s21c1
Sequence:CCGGTGTCGAAGCCTCCTCTGAATGCTCGAGCATTCAGAGGAGGCTTCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001500.2-990s21c1
Sequence:CCGGAGCCGGAGGACTTCGTTATAGCTCGAGCTATAACGAAGTCCTCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001500.2-646s21c1
Sequence:CCGGAGCCTCAACAAGTGAACTTTACTCGAGTAAAGTTCACTTGTTGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001500
VALIDATED
GMDS MISSION shRNA shRNA Plasmid DNA
GDP-mannose 4,6-dehydratase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001500.2-462s1c1
Sequence:CCGGCCTGCCTTGTGAAGATCATTACTCGAGTAATGATCTTCACAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001500.2-363s1c1
Sequence:CCGGGTTCATTTAATACGGGTCGAACTCGAGTTCGACCCGTATTAAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001500.2-861s1c1
Sequence:CCGGGCCGGTCAGTAGCTAAGATTTCTCGAGAAATCTTAGCTACTGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001500.2-770s1c1
Sequence:CCGGCGTGAGGCGTATAATCTCTTTCTCGAGAAAGAGATTATACGCCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001500.2-1045s1c1
Sequence:CCGGCGAGAAATCATTCTTGCACATCTCGAGATGTGCAAGAATGATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001500.2-824s21c1
Sequence:CCGGCCCAGAAGAGGAGCTAATTTCCTCGAGGAAATTAGCTCCTCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001500.2-1523s21c1
Sequence:CCGGTGTCGAAGCCTCCTCTGAATGCTCGAGCATTCAGAGGAGGCTTCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001500.2-990s21c1
Sequence:CCGGAGCCGGAGGACTTCGTTATAGCTCGAGCTATAACGAAGTCCTCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001500.2-646s21c1
Sequence:CCGGAGCCTCAACAAGTGAACTTTACTCGAGTAAAGTTCACTTGTTGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001500
VALIDATED
GMDS MISSION shRNA Lentiviral Transduction Particles
GDP-mannose 4,6-dehydratase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001500.2-462s1c1
Sequence:CCGGCCTGCCTTGTGAAGATCATTACTCGAGTAATGATCTTCACAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001500.2-363s1c1
Sequence:CCGGGTTCATTTAATACGGGTCGAACTCGAGTTCGACCCGTATTAAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001500.2-861s1c1
Sequence:CCGGGCCGGTCAGTAGCTAAGATTTCTCGAGAAATCTTAGCTACTGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001500.2-770s1c1
Sequence:CCGGCGTGAGGCGTATAATCTCTTTCTCGAGAAAGAGATTATACGCCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001500.2-1045s1c1
Sequence:CCGGCGAGAAATCATTCTTGCACATCTCGAGATGTGCAAGAATGATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001500.2-824s21c1
Sequence:CCGGCCCAGAAGAGGAGCTAATTTCCTCGAGGAAATTAGCTCCTCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001500.2-1523s21c1
Sequence:CCGGTGTCGAAGCCTCCTCTGAATGCTCGAGCATTCAGAGGAGGCTTCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001500.2-990s21c1
Sequence:CCGGAGCCGGAGGACTTCGTTATAGCTCGAGCTATAACGAAGTCCTCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001500.2-646s21c1
Sequence:CCGGAGCCTCAACAAGTGAACTTTACTCGAGTAAAGTTCACTTGTTGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks