EMAIL THIS PAGE TO A FRIEND

GMEB1

glucocorticoid modulatory element binding protein 1

Synonyms: P96PIF PIF96
UniProtKB ID: Q9Y692, B1AT48, Q9NWH1, Q9UKD0
Gene ID:
Human(10691) Summary: This gene encodes a member of KDWK gene family which associates with GMEB2 protein. The GMEB1-GMEB2 complex is essential for parvovirus DNA replication. Studies in rat for a similar gene suggest that this gene's role is to modulate the transactivation of the glucocorticoid receptor when it is bound to glucocorticoid response elements. Two alternative spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Feb 2011]
Mouse(56809) glucocorticoid modulatory element binding protein 1
Rat(500558) glucocorticoid modulatory element binding protein 1
Zebrafish(567701) glucocorticoid modulatory element binding protein 1
chicken(769918) glucocorticoid modulatory element binding protein 1
domestic cat(101088175) glucocorticoid modulatory element binding protein 1
cow(540374) glucocorticoid modulatory element binding protein 1
Horse(100056460) glucocorticoid modulatory element binding protein 1
dog(487330) glucocorticoid modulatory element binding protein 1
domestic guinea pig(100717470) glucocorticoid modulatory element binding protein 1
naked mole-rat(101720304) glucocorticoid modulatory element binding protein 1
sheep(101123099) glucocorticoid modulatory element binding protein 1
Domestic Rabbit(100351929) glucocorticoid modulatory element binding protein 1
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020273 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020273 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020273 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006582 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006582 Rosetta Predictions human pricing
NM_024482 Rosetta Predictions human pricing
NM_001109268 Rosetta Predictions rat pricing
NM_001122992 Rosetta Predictions mouse pricing
NM_020273 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199266 predicted 682
2 SASI_Hs01_00199267 predicted 1602
3 SASI_Hs01_00199268 predicted 573
4 SASI_Hs01_00199269 predicted 1131
5 SASI_Hs01_00199270 predicted 927
6 SASI_Hs01_00199271 predicted 1106
7 SASI_Hs01_00199272 predicted 1338
8 SASI_Hs01_00199273 predicted 963
9 SASI_Hs01_00199274 predicted 1128
10 SASI_Hs02_00341875 predicted 1651
11 SASI_Hs01_00199275 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072720 predicted 656
2 SASI_Hs01_00072721 predicted 1574
3 SASI_Hs01_00072722 predicted 538
4 SASI_Hs01_00072723 predicted 1094
5 SASI_Hs01_00072724 predicted 888
6 SASI_Hs01_00072725 predicted 1074
7 SASI_Hs01_00072726 predicted 1305
8 SASI_Hs01_00072727 predicted 928
9 SASI_Hs01_00072728 predicted 1100
10 SASI_Hs02_00356754 predicted 1618
11 SASI_Hs01_00072729 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246744 predicted 1456
2 SASI_Rn02_00246745 predicted 545
3 SASI_Rn02_00246746 predicted 1009
4 SASI_Rn02_00246747 predicted 579
5 SASI_Rn02_00246748 predicted 782
6 SASI_Rn02_00246749 predicted 1094
7 SASI_Rn02_00246750 predicted 269
8 SASI_Rn02_00246751 predicted 273
9 SASI_Rn02_00246752 predicted 1409
10 SASI_Rn02_00246753 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309739 predicted 496
2 SASI_Mm02_00309740 predicted 625
3 SASI_Mm02_00309741 predicted 1645
4 SASI_Mm02_00309742 predicted 1186
5 SASI_Mm02_00309743 predicted 478
6 SASI_Mm02_00309744 predicted 845
7 SASI_Mm02_00309745 predicted 1220
8 SASI_Mm02_00309746 predicted 1335
9 SASI_Mm02_00309747 predicted 1517
10 SASI_Mm02_00309748 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020273 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080413 predicted 436
2 SASI_Mm01_00080415 predicted 569
3 SASI_Mm02_00325465 predicted 1583
4 SASI_Mm02_00325466 predicted 1119
5 SASI_Mm01_00080416 predicted 414
6 SASI_Mm01_00080417 predicted 786
7 SASI_Mm01_00080418 predicted 1152
8 SASI_Mm01_00080420 predicted 1276
9 SASI_Mm01_00080421 predicted 1458
10 SASI_Mm01_00080422 predicted 599
11 SASI_Mm01_00080414 predicted 361
12 SASI_Mm01_00080419 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020273
VALIDATED
GMEB1 MISSION shRNA Bacterial Glycerol Stock
glucocorticoid modulatory element binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020273.2-223s21c1
Sequence:CCGGATGAAGCTGGGTCGGAGAATACTCGAGTATTCTCCGACCCAGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020273.2-4433s21c1
Sequence:CCGGCAGACCTGGTCTAGATTATTTCTCGAGAAATAATCTAGACCAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020273.2-259s21c1
Sequence:CCGGCCGTAGAGACCCACTCAATACCTCGAGGTATTGAGTGGGTCTCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020273.2-776s21c1
Sequence:CCGGGGCCACAGAGGAGGGTATAAACTCGAGTTTATACCCTCCTCTGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020273.2-332s21c1
Sequence:CCGGGGAGATCGCTTACCCTATAACCTCGAGGTTATAGGGTAAGCGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020273.1-1805s1c1
Sequence:CCGGCCCGCTCATTTCCACATAGAACTCGAGTTCTATGTGGAAATGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020273.1-1701s1c1
Sequence:CCGGCAGGTCCACAATGTGGAGATTCTCGAGAATCTCCACATTGTGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020273.1-163s1c1
Sequence:CCGGAGCCTGTGCAACAAGGGATTTCTCGAGAAATCCCTTGTTGCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020273.1-527s1c1
Sequence:CCGGGCATGACAAAGTTTGCTCCAACTCGAGTTGGAGCAAACTTTGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020273.1-1420s1c1
Sequence:CCGGCCTCAAGTTTGGCACTGCTAACTCGAGTTAGCAGTGCCAAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020273
VALIDATED
GMEB1 MISSION shRNA shRNA Plasmid DNA
glucocorticoid modulatory element binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020273.2-223s21c1
Sequence:CCGGATGAAGCTGGGTCGGAGAATACTCGAGTATTCTCCGACCCAGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020273.2-4433s21c1
Sequence:CCGGCAGACCTGGTCTAGATTATTTCTCGAGAAATAATCTAGACCAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020273.2-259s21c1
Sequence:CCGGCCGTAGAGACCCACTCAATACCTCGAGGTATTGAGTGGGTCTCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020273.2-776s21c1
Sequence:CCGGGGCCACAGAGGAGGGTATAAACTCGAGTTTATACCCTCCTCTGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020273.2-332s21c1
Sequence:CCGGGGAGATCGCTTACCCTATAACCTCGAGGTTATAGGGTAAGCGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020273.1-1805s1c1
Sequence:CCGGCCCGCTCATTTCCACATAGAACTCGAGTTCTATGTGGAAATGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020273.1-1701s1c1
Sequence:CCGGCAGGTCCACAATGTGGAGATTCTCGAGAATCTCCACATTGTGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020273.1-163s1c1
Sequence:CCGGAGCCTGTGCAACAAGGGATTTCTCGAGAAATCCCTTGTTGCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020273.1-527s1c1
Sequence:CCGGGCATGACAAAGTTTGCTCCAACTCGAGTTGGAGCAAACTTTGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020273.1-1420s1c1
Sequence:CCGGCCTCAAGTTTGGCACTGCTAACTCGAGTTAGCAGTGCCAAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020273
VALIDATED
GMEB1 MISSION shRNA Lentiviral Transduction Particles
glucocorticoid modulatory element binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020273.2-223s21c1
Sequence:CCGGATGAAGCTGGGTCGGAGAATACTCGAGTATTCTCCGACCCAGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020273.2-4433s21c1
Sequence:CCGGCAGACCTGGTCTAGATTATTTCTCGAGAAATAATCTAGACCAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020273.2-259s21c1
Sequence:CCGGCCGTAGAGACCCACTCAATACCTCGAGGTATTGAGTGGGTCTCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020273.2-776s21c1
Sequence:CCGGGGCCACAGAGGAGGGTATAAACTCGAGTTTATACCCTCCTCTGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020273.2-332s21c1
Sequence:CCGGGGAGATCGCTTACCCTATAACCTCGAGGTTATAGGGTAAGCGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020273.1-1805s1c1
Sequence:CCGGCCCGCTCATTTCCACATAGAACTCGAGTTCTATGTGGAAATGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020273.1-1701s1c1
Sequence:CCGGCAGGTCCACAATGTGGAGATTCTCGAGAATCTCCACATTGTGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020273.1-163s1c1
Sequence:CCGGAGCCTGTGCAACAAGGGATTTCTCGAGAAATCCCTTGTTGCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020273.1-527s1c1
Sequence:CCGGGCATGACAAAGTTTGCTCCAACTCGAGTTGGAGCAAACTTTGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020273.1-1420s1c1
Sequence:CCGGCCTCAAGTTTGGCACTGCTAACTCGAGTTAGCAGTGCCAAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006582
VALIDATED
GMEB1 MISSION shRNA Bacterial Glycerol Stock
glucocorticoid modulatory element binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-764s21c1
Sequence:CCGGATGGTAGCATCACGCAGATTGCTCGAGCAATCTGCGTGATGCTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-1060s21c1
Sequence:CCGGGCACACACATTTGGCCTAATGCTCGAGCATTAGGCCAAATGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-666s21c1
Sequence:CCGGTACCTGCAGAAGCACCAAATTCTCGAGAATTTGGTGCTTCTGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-374s21c1
Sequence:CCGGGGATTGATACAGGCACTATAGCTCGAGCTATAGTGCCTGTATCAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-618s21c1
Sequence:CCGGGGACTCCGGACAGATTGATTTCTCGAGAAATCAATCTGTCCGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006582.2-1074s1c1
Sequence:CCGGCCTAATGGACACAGTCAAGAACTCGAGTTCTTGACTGTGTCCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006582.2-1693s1c1
Sequence:CCGGCAGACCATCATTGAGATTGATCTCGAGATCAATCTCAATGATGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006582.2-646s1c1
Sequence:CCGGCATGACAAAGTTTGCTCCAATCTCGAGATTGGAGCAAACTTTGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006582.2-326s1c1
Sequence:CCGGCGGCAGTTGTAGCAGTAGAAACTCGAGTTTCTACTGCTACAACTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006582.2-254s1c1
Sequence:CCGGCTGTGCAACAAGGTTTGTTTACTCGAGTAAACAAACCTTGTTGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006582
VALIDATED
GMEB1 MISSION shRNA shRNA Plasmid DNA
glucocorticoid modulatory element binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-764s21c1
Sequence:CCGGATGGTAGCATCACGCAGATTGCTCGAGCAATCTGCGTGATGCTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-1060s21c1
Sequence:CCGGGCACACACATTTGGCCTAATGCTCGAGCATTAGGCCAAATGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-666s21c1
Sequence:CCGGTACCTGCAGAAGCACCAAATTCTCGAGAATTTGGTGCTTCTGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-374s21c1
Sequence:CCGGGGATTGATACAGGCACTATAGCTCGAGCTATAGTGCCTGTATCAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-618s21c1
Sequence:CCGGGGACTCCGGACAGATTGATTTCTCGAGAAATCAATCTGTCCGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006582.2-1074s1c1
Sequence:CCGGCCTAATGGACACAGTCAAGAACTCGAGTTCTTGACTGTGTCCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006582.2-1693s1c1
Sequence:CCGGCAGACCATCATTGAGATTGATCTCGAGATCAATCTCAATGATGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006582.2-646s1c1
Sequence:CCGGCATGACAAAGTTTGCTCCAATCTCGAGATTGGAGCAAACTTTGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006582.2-326s1c1
Sequence:CCGGCGGCAGTTGTAGCAGTAGAAACTCGAGTTTCTACTGCTACAACTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006582.2-254s1c1
Sequence:CCGGCTGTGCAACAAGGTTTGTTTACTCGAGTAAACAAACCTTGTTGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006582
VALIDATED
GMEB1 MISSION shRNA Lentiviral Transduction Particles
glucocorticoid modulatory element binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-764s21c1
Sequence:CCGGATGGTAGCATCACGCAGATTGCTCGAGCAATCTGCGTGATGCTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-1060s21c1
Sequence:CCGGGCACACACATTTGGCCTAATGCTCGAGCATTAGGCCAAATGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-666s21c1
Sequence:CCGGTACCTGCAGAAGCACCAAATTCTCGAGAATTTGGTGCTTCTGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-374s21c1
Sequence:CCGGGGATTGATACAGGCACTATAGCTCGAGCTATAGTGCCTGTATCAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006582.2-618s21c1
Sequence:CCGGGGACTCCGGACAGATTGATTTCTCGAGAAATCAATCTGTCCGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006582.2-1074s1c1
Sequence:CCGGCCTAATGGACACAGTCAAGAACTCGAGTTCTTGACTGTGTCCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006582.2-1693s1c1
Sequence:CCGGCAGACCATCATTGAGATTGATCTCGAGATCAATCTCAATGATGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006582.2-646s1c1
Sequence:CCGGCATGACAAAGTTTGCTCCAATCTCGAGATTGGAGCAAACTTTGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006582.2-326s1c1
Sequence:CCGGCGGCAGTTGTAGCAGTAGAAACTCGAGTTTCTACTGCTACAACTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006582.2-254s1c1
Sequence:CCGGCTGTGCAACAAGGTTTGTTTACTCGAGTAAACAAACCTTGTTGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks