EMAIL THIS PAGE TO A FRIEND

GMEB2

glucocorticoid modulatory element binding protein 2

94 Gene Product Result for
Synonyms: P79PIF PIF79
Gene ID:
Human(26205) Summary: This gene is a member of KDWK gene family. The product of this gene associates with GMEB1 protein, and the complex is essential for parvovirus DNA replication. Study of rat homolog implicates the role of this gene in modulation of transactivation by the glucocorticoid receptor bound to glucocorticoid response elements. This gene appears to use multiple polyadenylation sites. [provided by RefSeq, Jul 2008]
Mouse(229004) glucocorticoid modulatory element binding protein 2
Rat(83635) glucocorticoid modulatory element binding protein 2
sheep(101117866) glucocorticoid modulatory element binding protein 2
Domestic Rabbit(100338802) glucocorticoid modulatory element binding protein 2
domestic guinea pig(100730793) glucocorticoid modulatory element binding protein 2
naked mole-rat(101723778) glucocorticoid modulatory element binding protein 2
chicken(419264) glucocorticoid modulatory element binding protein 2
dog(485975) glucocorticoid modulatory element binding protein 2
domestic cat(101099540) glucocorticoid modulatory element binding protein 2
cow(508301) glucocorticoid modulatory element binding protein 2
Horse(100060635) glucocorticoid modulatory element binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198169 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198169 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198169 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012384 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012384 Rosetta Predictions human pricing
NM_031803 Rosetta Predictions rat pricing
NM_198169 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196326 predicted 1153
2 SASI_Hs02_00344186 predicted 918
3 SASI_Hs01_00196327 predicted 914
4 SASI_Hs01_00196328 predicted 2517
5 SASI_Hs01_00196329 predicted 771
6 SASI_Hs01_00196330 predicted 2233
7 SASI_Hs01_00196331 predicted 1551
8 SASI_Hs01_00196332 predicted 902
9 SASI_Hs01_00196333 predicted 2187
10 SASI_Hs01_00196334 predicted 2110
11 SASI_Hs01_00196335 predicted 1872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034784 predicted 833
2 SASI_Rn01_00034785 predicted 1013
3 SASI_Rn01_00034786 predicted 1125
4 SASI_Rn02_00265250 predicted 783
5 SASI_Rn01_00034787 predicted 432
6 SASI_Rn01_00034788 predicted 604
7 SASI_Rn01_00034789 predicted 539
8 SASI_Rn01_00034790 predicted 1230
9 SASI_Rn01_00034791 predicted 1104
10 SASI_Rn01_00034793 predicted 447
11 SASI_Rn01_00034792 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147980 predicted 852
2 SASI_Mm01_00147981 predicted 622
3 SASI_Mm01_00147982 predicted 371
4 SASI_Mm01_00147983 predicted 211
5 SASI_Mm01_00147984 predicted 367
6 SASI_Mm01_00147985 predicted 1145
7 SASI_Mm01_00147986 predicted 877
8 SASI_Mm01_00147987 predicted 1581
9 SASI_Mm01_00147988 predicted 898
10 SASI_Mm01_00147989 predicted 526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198169
GMEB2 MISSION shRNA Bacterial Glycerol Stock
glucocorticoid modulatory element binding protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198169.1-1860s1c1
Sequence:CCGGCGGATGAATCAAGAGAAGAAACTCGAGTTTCTTCTCTTGATTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198169.1-652s1c1
Sequence:CCGGGCAGCACGAAGATTGACCTTTCTCGAGAAAGGTCAATCTTCGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198169.1-1255s1c1
Sequence:CCGGCACAGTCTGCACAGATTGCTTCTCGAGAAGCAATCTGTGCAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198169.1-1618s1c1
Sequence:CCGGGCACCATTGTGACAATGCCTACTCGAGTAGGCATTGTCACAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198169.1-694s1c1
Sequence:CCGGGCAGTCCTACATCCACAGAATCTCGAGATTCTGTGGATGTAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198169.2-1042s21c1
Sequence:CCGGATCGTTCCCGGGAACAGTATGCTCGAGCATACTGTTCCCGGGAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198169.2-418s21c1
Sequence:CCGGACAGCAGAGCTAACCTCATTTCTCGAGAAATGAGGTTAGCTCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198169.2-1964s21c1
Sequence:CCGGTTCCATCTGTTGCTTATTAATCTCGAGATTAATAAGCAACAGATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198169.2-626s21c1
Sequence:CCGGTGACAAGGTCTGCTCTAATACCTCGAGGTATTAGAGCAGACCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198169
GMEB2 MISSION shRNA shRNA Plasmid DNA
glucocorticoid modulatory element binding protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198169.1-1860s1c1
Sequence:CCGGCGGATGAATCAAGAGAAGAAACTCGAGTTTCTTCTCTTGATTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198169.1-652s1c1
Sequence:CCGGGCAGCACGAAGATTGACCTTTCTCGAGAAAGGTCAATCTTCGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198169.1-1255s1c1
Sequence:CCGGCACAGTCTGCACAGATTGCTTCTCGAGAAGCAATCTGTGCAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198169.1-1618s1c1
Sequence:CCGGGCACCATTGTGACAATGCCTACTCGAGTAGGCATTGTCACAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198169.1-694s1c1
Sequence:CCGGGCAGTCCTACATCCACAGAATCTCGAGATTCTGTGGATGTAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198169.2-1042s21c1
Sequence:CCGGATCGTTCCCGGGAACAGTATGCTCGAGCATACTGTTCCCGGGAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198169.2-418s21c1
Sequence:CCGGACAGCAGAGCTAACCTCATTTCTCGAGAAATGAGGTTAGCTCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198169.2-1964s21c1
Sequence:CCGGTTCCATCTGTTGCTTATTAATCTCGAGATTAATAAGCAACAGATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198169.2-626s21c1
Sequence:CCGGTGACAAGGTCTGCTCTAATACCTCGAGGTATTAGAGCAGACCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198169
GMEB2 MISSION shRNA Lentiviral Transduction Particles
glucocorticoid modulatory element binding protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198169.1-1860s1c1
Sequence:CCGGCGGATGAATCAAGAGAAGAAACTCGAGTTTCTTCTCTTGATTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198169.1-652s1c1
Sequence:CCGGGCAGCACGAAGATTGACCTTTCTCGAGAAAGGTCAATCTTCGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198169.1-1255s1c1
Sequence:CCGGCACAGTCTGCACAGATTGCTTCTCGAGAAGCAATCTGTGCAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198169.1-1618s1c1
Sequence:CCGGGCACCATTGTGACAATGCCTACTCGAGTAGGCATTGTCACAATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198169.1-694s1c1
Sequence:CCGGGCAGTCCTACATCCACAGAATCTCGAGATTCTGTGGATGTAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198169.2-1042s21c1
Sequence:CCGGATCGTTCCCGGGAACAGTATGCTCGAGCATACTGTTCCCGGGAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198169.2-418s21c1
Sequence:CCGGACAGCAGAGCTAACCTCATTTCTCGAGAAATGAGGTTAGCTCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198169.2-1964s21c1
Sequence:CCGGTTCCATCTGTTGCTTATTAATCTCGAGATTAATAAGCAACAGATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198169.2-626s21c1
Sequence:CCGGTGACAAGGTCTGCTCTAATACCTCGAGGTATTAGAGCAGACCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012384
VALIDATED
GMEB2 MISSION shRNA Bacterial Glycerol Stock
glucocorticoid modulatory element binding protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012384.2-1162s1c1
Sequence:CCGGCCATTGGAGATGACACATTTACTCGAGTAAATGTGTCATCTCCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012384.2-624s1c1
Sequence:CCGGGAAGATAACATGGAGACAGAACTCGAGTTCTGTCTCCATGTTATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012384.2-782s1c1
Sequence:CCGGCAACCTCATCTGGAGGAAGTTCTCGAGAACTTCCTCCAGATGAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_012384.2-831s1c1
Sequence:CCGGGTTCAGTACGACGAGCATGTACTCGAGTACATGCTCGTCGTACTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012384.2-1299s1c1
Sequence:CCGGCAGCTTCGAGATGCTGTACTTCTCGAGAAGTACAGCATCTCGAAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012384.2-2797s21c1
Sequence:CCGGTCTAGGAAGAGTCAGATTTATCTCGAGATAAATCTGACTCTTCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012384.2-1161s21c1
Sequence:CCGGGCCATTGGAGATGACACATTTCTCGAGAAATGTGTCATCTCCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012384.2-833s21c1
Sequence:CCGGTCAGTACGACGAGCATGTAATCTCGAGATTACATGCTCGTCGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012384.2-802s21c1
Sequence:CCGGTTGTGTGTCCCGGCATCAATGCTCGAGCATTGATGCCGGGACACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012384.2-688s21c1
Sequence:CCGGAGCTCAAGGAAGCCGTGTTAGCTCGAGCTAACACGGCTTCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012384
VALIDATED
GMEB2 MISSION shRNA shRNA Plasmid DNA
glucocorticoid modulatory element binding protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012384.2-1162s1c1
Sequence:CCGGCCATTGGAGATGACACATTTACTCGAGTAAATGTGTCATCTCCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012384.2-624s1c1
Sequence:CCGGGAAGATAACATGGAGACAGAACTCGAGTTCTGTCTCCATGTTATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012384.2-782s1c1
Sequence:CCGGCAACCTCATCTGGAGGAAGTTCTCGAGAACTTCCTCCAGATGAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_012384.2-831s1c1
Sequence:CCGGGTTCAGTACGACGAGCATGTACTCGAGTACATGCTCGTCGTACTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012384.2-1299s1c1
Sequence:CCGGCAGCTTCGAGATGCTGTACTTCTCGAGAAGTACAGCATCTCGAAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012384.2-2797s21c1
Sequence:CCGGTCTAGGAAGAGTCAGATTTATCTCGAGATAAATCTGACTCTTCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012384.2-1161s21c1
Sequence:CCGGGCCATTGGAGATGACACATTTCTCGAGAAATGTGTCATCTCCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012384.2-833s21c1
Sequence:CCGGTCAGTACGACGAGCATGTAATCTCGAGATTACATGCTCGTCGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012384.2-802s21c1
Sequence:CCGGTTGTGTGTCCCGGCATCAATGCTCGAGCATTGATGCCGGGACACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012384.2-688s21c1
Sequence:CCGGAGCTCAAGGAAGCCGTGTTAGCTCGAGCTAACACGGCTTCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012384
VALIDATED
GMEB2 MISSION shRNA Lentiviral Transduction Particles
glucocorticoid modulatory element binding protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012384.2-1162s1c1
Sequence:CCGGCCATTGGAGATGACACATTTACTCGAGTAAATGTGTCATCTCCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012384.2-624s1c1
Sequence:CCGGGAAGATAACATGGAGACAGAACTCGAGTTCTGTCTCCATGTTATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012384.2-782s1c1
Sequence:CCGGCAACCTCATCTGGAGGAAGTTCTCGAGAACTTCCTCCAGATGAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_012384.2-831s1c1
Sequence:CCGGGTTCAGTACGACGAGCATGTACTCGAGTACATGCTCGTCGTACTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012384.2-1299s1c1
Sequence:CCGGCAGCTTCGAGATGCTGTACTTCTCGAGAAGTACAGCATCTCGAAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012384.2-2797s21c1
Sequence:CCGGTCTAGGAAGAGTCAGATTTATCTCGAGATAAATCTGACTCTTCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012384.2-1161s21c1
Sequence:CCGGGCCATTGGAGATGACACATTTCTCGAGAAATGTGTCATCTCCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012384.2-833s21c1
Sequence:CCGGTCAGTACGACGAGCATGTAATCTCGAGATTACATGCTCGTCGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012384.2-802s21c1
Sequence:CCGGTTGTGTGTCCCGGCATCAATGCTCGAGCATTGATGCCGGGACACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012384.2-688s21c1
Sequence:CCGGAGCTCAAGGAAGCCGTGTTAGCTCGAGCTAACACGGCTTCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks