EMAIL THIS PAGE TO A FRIEND

GMFB

glia maturation factor, beta

224 Gene Product Result for
Synonyms: GMF
UniProtKB ID: P60983, B2R499, P17774
Gene ID:
Mouse(63985) glia maturation factor, beta
Rat(81661) glia maturation factor, beta
Zebrafish(406384) glia maturation factor, beta
cow(615255) glia maturation factor, beta
domestic cat(101101226) glia maturation factor, beta
dog(610927) glia maturation factor, beta
chicken(423560) glia maturation factor, beta
sheep(101116913) glia maturation factor, beta
domestic guinea pig(100732117) glia maturation factor, beta
naked mole-rat(101709653) glia maturation factor, beta
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022023 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022023 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022023 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004124 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004124 Rosetta Predictions human pricing
NM_031032 Rosetta Predictions rat pricing
NM_022023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015505 predicted 573
2 SASI_Hs01_00015507 predicted 302
3 SASI_Hs01_00015509 predicted 609
4 SASI_Hs02_00336974 predicted 578
5 SASI_Hs01_00015510 predicted 480
6 SASI_Hs01_00015511 predicted 204
7 SASI_Hs01_00015512 predicted 439
8 SASI_Hs02_00336975 predicted 398
9 SASI_Hs01_00015514 predicted 475
10 SASI_Hs02_00336976 predicted 481
11 SASI_Hs01_00015506 predicted 250
12 SASI_Hs01_00015508 predicted 302
13 SASI_Hs01_00015513 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050684 predicted 561
2 SASI_Rn01_00050685 predicted 751
3 SASI_Rn01_00050686 predicted 520
4 SASI_Rn01_00050688 predicted 466
5 SASI_Rn01_00050689 predicted 519
6 SASI_Rn01_00050690 predicted 703
7 SASI_Rn01_00050691 predicted 789
8 SASI_Rn01_00050692 predicted 637
9 SASI_Rn01_00050693 predicted 235
10 SASI_Rn02_00264236 predicted 768
11 SASI_Rn01_00050687 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108972 predicted 621
2 SASI_Mm01_00108973 predicted 696
3 SASI_Mm01_00108975 predicted 738
4 SASI_Mm01_00108976 predicted 670
5 SASI_Mm01_00108977 predicted 819
6 SASI_Mm01_00108978 predicted 841
7 SASI_Mm01_00108979 predicted 337
8 SASI_Mm01_00108980 predicted 519
9 SASI_Mm01_00108981 predicted 334
10 SASI_Mm02_00326498 predicted 214
11 SASI_Mm01_00108974 predicted 567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022023
VALIDATED
GMFB MISSION shRNA Bacterial Glycerol Stock
glia maturation factor, beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022023.2-868s21c1
Sequence:CCGGCTATAGGAAGGTGGGTATTAGCTCGAGCTAATACCCACCTTCCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022023.2-484s21c1
Sequence:CCGGCGAGCTAACCAAGGTATTTGACTCGAGTCAAATACCTTGGTTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022023.2-292s21c1
Sequence:CCGGTGTCTCTCCAGATGAACTTAACTCGAGTTAAGTTCATCTGGAGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022023.2-386s21c1
Sequence:CCGGTCGTACCCGCTCTGCTTTATTCTCGAGAATAAAGCAGAGCGGGTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022023.2-539s21c1
Sequence:CCGGTTACGTGAGAAACTTGGATTTCTCGAGAAATCCAAGTTTCTCACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022023.1-430s1c1
Sequence:CCGGGCTGGGAGTAAGAACAAGCTACTCGAGTAGCTTGTTCTTACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022023.1-462s1c1
Sequence:CCGGCGAGCTAACCAAGGTATTTGACTCGAGTCAAATACCTTGGTTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022023.1-3845s1c1
Sequence:CCGGCGCTTATGATAGAAACAGTTTCTCGAGAAACTGTTTCTATCATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022023.1-313s1c1
Sequence:CCGGCCTCGCTTCATTGTGTATAGTCTCGAGACTATACACAATGAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022023.1-197s1c1
Sequence:CCGGCCCACAATGCTGCTATTATAACTCGAGTTATAATAGCAGCATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022023
VALIDATED
GMFB MISSION shRNA shRNA Plasmid DNA
glia maturation factor, beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022023.2-868s21c1
Sequence:CCGGCTATAGGAAGGTGGGTATTAGCTCGAGCTAATACCCACCTTCCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022023.2-484s21c1
Sequence:CCGGCGAGCTAACCAAGGTATTTGACTCGAGTCAAATACCTTGGTTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022023.2-292s21c1
Sequence:CCGGTGTCTCTCCAGATGAACTTAACTCGAGTTAAGTTCATCTGGAGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022023.2-386s21c1
Sequence:CCGGTCGTACCCGCTCTGCTTTATTCTCGAGAATAAAGCAGAGCGGGTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022023.2-539s21c1
Sequence:CCGGTTACGTGAGAAACTTGGATTTCTCGAGAAATCCAAGTTTCTCACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022023.1-430s1c1
Sequence:CCGGGCTGGGAGTAAGAACAAGCTACTCGAGTAGCTTGTTCTTACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022023.1-462s1c1
Sequence:CCGGCGAGCTAACCAAGGTATTTGACTCGAGTCAAATACCTTGGTTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022023.1-3845s1c1
Sequence:CCGGCGCTTATGATAGAAACAGTTTCTCGAGAAACTGTTTCTATCATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022023.1-313s1c1
Sequence:CCGGCCTCGCTTCATTGTGTATAGTCTCGAGACTATACACAATGAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022023.1-197s1c1
Sequence:CCGGCCCACAATGCTGCTATTATAACTCGAGTTATAATAGCAGCATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022023
VALIDATED
GMFB MISSION shRNA Lentiviral Transduction Particles
glia maturation factor, beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022023.2-868s21c1
Sequence:CCGGCTATAGGAAGGTGGGTATTAGCTCGAGCTAATACCCACCTTCCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022023.2-484s21c1
Sequence:CCGGCGAGCTAACCAAGGTATTTGACTCGAGTCAAATACCTTGGTTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022023.2-292s21c1
Sequence:CCGGTGTCTCTCCAGATGAACTTAACTCGAGTTAAGTTCATCTGGAGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022023.2-386s21c1
Sequence:CCGGTCGTACCCGCTCTGCTTTATTCTCGAGAATAAAGCAGAGCGGGTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022023.2-539s21c1
Sequence:CCGGTTACGTGAGAAACTTGGATTTCTCGAGAAATCCAAGTTTCTCACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022023.1-430s1c1
Sequence:CCGGGCTGGGAGTAAGAACAAGCTACTCGAGTAGCTTGTTCTTACTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022023.1-462s1c1
Sequence:CCGGCGAGCTAACCAAGGTATTTGACTCGAGTCAAATACCTTGGTTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022023.1-3845s1c1
Sequence:CCGGCGCTTATGATAGAAACAGTTTCTCGAGAAACTGTTTCTATCATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022023.1-313s1c1
Sequence:CCGGCCTCGCTTCATTGTGTATAGTCTCGAGACTATACACAATGAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022023.1-197s1c1
Sequence:CCGGCCCACAATGCTGCTATTATAACTCGAGTTATAATAGCAGCATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004124
VALIDATED
GMFB MISSION shRNA Bacterial Glycerol Stock
glia maturation factor, beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004124.2-1321s21c1
Sequence:CCGGGCCTTTGATTTGTTAGCTTTACTCGAGTAAAGCTAACAAATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004124.2-298s21c1
Sequence:CCGGCGCTTCATTGTGTATAGTTATCTCGAGATAACTATACACAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004124.2-175s21c1
Sequence:CCGGGAAACGAACAACGCTGCTATTCTCGAGAATAGCAGCGTTGTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004124.2-490s21c1
Sequence:CCGGGAAGAATGGTTACGTGAGAAACTCGAGTTTCTCACGTAACCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004124.2-343s21c1
Sequence:CCGGGTTTCATATCCTCTGTGCTTTCTCGAGAAAGCACAGAGGATATGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004124.x-490s1c1
Sequence:CCGGGAAGAATGGTTACGTGAGAAACTCGAGTTTCTCACGTAACCATTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004124.x-343s1c1
Sequence:CCGGGTTTCATATCCTCTGTGCTTTCTCGAGAAAGCACAGAGGATATGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004124.x-175s1c1
Sequence:CCGGGAAACGAACAACGCTGCTATTCTCGAGAATAGCAGCGTTGTTCGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004124.x-298s1c1
Sequence:CCGGCGCTTCATTGTGTATAGTTATCTCGAGATAACTATACACAATGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004124.x-1321s1c1
Sequence:CCGGGCCTTTGATTTGTTAGCTTTACTCGAGTAAAGCTAACAAATCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004124
VALIDATED
GMFB MISSION shRNA shRNA Plasmid DNA
glia maturation factor, beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004124.2-1321s21c1
Sequence:CCGGGCCTTTGATTTGTTAGCTTTACTCGAGTAAAGCTAACAAATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004124.2-298s21c1
Sequence:CCGGCGCTTCATTGTGTATAGTTATCTCGAGATAACTATACACAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004124.2-175s21c1
Sequence:CCGGGAAACGAACAACGCTGCTATTCTCGAGAATAGCAGCGTTGTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004124.2-490s21c1
Sequence:CCGGGAAGAATGGTTACGTGAGAAACTCGAGTTTCTCACGTAACCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004124.2-343s21c1
Sequence:CCGGGTTTCATATCCTCTGTGCTTTCTCGAGAAAGCACAGAGGATATGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004124.x-490s1c1
Sequence:CCGGGAAGAATGGTTACGTGAGAAACTCGAGTTTCTCACGTAACCATTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004124.x-343s1c1
Sequence:CCGGGTTTCATATCCTCTGTGCTTTCTCGAGAAAGCACAGAGGATATGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004124.x-175s1c1
Sequence:CCGGGAAACGAACAACGCTGCTATTCTCGAGAATAGCAGCGTTGTTCGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004124.x-298s1c1
Sequence:CCGGCGCTTCATTGTGTATAGTTATCTCGAGATAACTATACACAATGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004124.x-1321s1c1
Sequence:CCGGGCCTTTGATTTGTTAGCTTTACTCGAGTAAAGCTAACAAATCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004124
VALIDATED
GMFB MISSION shRNA Lentiviral Transduction Particles
glia maturation factor, beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004124.2-1321s21c1
Sequence:CCGGGCCTTTGATTTGTTAGCTTTACTCGAGTAAAGCTAACAAATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004124.2-298s21c1
Sequence:CCGGCGCTTCATTGTGTATAGTTATCTCGAGATAACTATACACAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004124.2-175s21c1
Sequence:CCGGGAAACGAACAACGCTGCTATTCTCGAGAATAGCAGCGTTGTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004124.2-490s21c1
Sequence:CCGGGAAGAATGGTTACGTGAGAAACTCGAGTTTCTCACGTAACCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004124.2-343s21c1
Sequence:CCGGGTTTCATATCCTCTGTGCTTTCTCGAGAAAGCACAGAGGATATGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004124.x-490s1c1
Sequence:CCGGGAAGAATGGTTACGTGAGAAACTCGAGTTTCTCACGTAACCATTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004124.x-343s1c1
Sequence:CCGGGTTTCATATCCTCTGTGCTTTCTCGAGAAAGCACAGAGGATATGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004124.x-175s1c1
Sequence:CCGGGAAACGAACAACGCTGCTATTCTCGAGAATAGCAGCGTTGTTCGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004124.x-298s1c1
Sequence:CCGGCGCTTCATTGTGTATAGTTATCTCGAGATAACTATACACAATGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004124.x-1321s1c1
Sequence:CCGGGCCTTTGATTTGTTAGCTTTACTCGAGTAAAGCTAACAAATCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks