EMAIL THIS PAGE TO A FRIEND

GMFG

glia maturation factor, gamma

69 Gene Product Result for
Synonyms: GMF-GAMMA
UniProtKB ID: O60234
Gene ID:
Mouse(63986) glia maturation factor, gamma
Rat(113940) glia maturation factor, gamma
Zebrafish(677752) glia maturation factor, gamma
dog(611578) glia maturation factor, gamma
cow(514407) glia maturation factor, gamma
domestic cat(101097857) glia maturation factor, gamma
domestic guinea pig(100732277) glia maturation factor, gamma
naked mole-rat(101723657) glia maturation factor, gamma
sheep(101114894) glia maturation factor, gamma
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
SRP6030 GMF-γ human recombinant, expressed in E. coli, ≥90% (SDS-PAGE) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004877 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004877 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004877 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056651 MISSION® esiRNA esiRNA human GMFG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004877 Rosetta Predictions human pricing
NM_181091 Rosetta Predictions rat pricing
NM_001039192 Rosetta Predictions mouse pricing
NM_022024 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134739 predicted 250
2 SASI_Hs01_00134740 predicted 300
3 SASI_Hs01_00134742 predicted 301
4 SASI_Hs01_00134743 predicted 205
5 SASI_Hs01_00134745 predicted 202
6 SASI_Hs01_00134746 predicted 295
7 SASI_Hs01_00134747 predicted 244
8 SASI_Hs01_00134748 predicted 237
9 SASI_Hs02_00338509 predicted 309
10 SASI_Hs02_00338510 predicted 202
11 SASI_Hs01_00134741 predicted 200
12 SASI_Hs01_00134744 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077515 predicted 205
2 SASI_Rn02_00269674 predicted 240
3 SASI_Rn01_00077516 predicted 302
4 SASI_Rn02_00269675 predicted 242
5 SASI_Rn01_00077517 predicted 250
6 SASI_Rn01_00077518 predicted 295
7 SASI_Rn01_00077519 predicted 304
8 SASI_Rn01_00077520 predicted 217
9 SASI_Rn01_00077523 predicted 198
10 SASI_Rn01_00077524 predicted 199
11 SASI_Rn01_00077521 predicted 258
12 SASI_Rn01_00077522 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093738 predicted 570
2 SASI_Mm01_00093739 predicted 340
3 SASI_Mm01_00093740 predicted 597
4 SASI_Mm01_00093741 predicted 313
5 SASI_Mm01_00093742 predicted 440
6 SASI_Mm01_00093743 predicted 407
7 SASI_Mm01_00093744 predicted 392
8 SASI_Mm02_00289935 predicted 504
9 SASI_Mm01_00093745 predicted 715
10 SASI_Mm01_00093746 predicted 450
11 SASI_Mm01_00093747 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063418 predicted 593
2 SASI_Mm01_00063419 predicted 369
3 SASI_Mm01_00063420 predicted 618
4 SASI_Mm01_00063421 predicted 333
5 SASI_Mm01_00063422 predicted 470
6 SASI_Mm01_00063423 predicted 422
7 SASI_Mm01_00063424 predicted 408
8 SASI_Mm02_00326499 predicted 526
9 SASI_Mm01_00063425 predicted 741
10 SASI_Mm01_00063426 predicted 470
11 SASI_Mm01_00063427 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022024
VALIDATED
GMFG MISSION shRNA Bacterial Glycerol Stock
glia maturation factor, gamma
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022024.1-155s1c1
Sequence:CCGGCCCGGAGCTAAAGGAAACATTCTCGAGAATGTTTCCTTTAGCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022024.1-336s1c1
Sequence:CCGGAGCTACAAGTACGTGCATGATCTCGAGATCATGCACGTACTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022024.1-370s1c1
Sequence:CCGGCCTATCCTTTGTGCTTCATCTCTCGAGAGATGAAGCACAAAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022024.1-176s1c1
Sequence:CCGGGAGGAAATTTCGTTTCCGAAACTCGAGTTTCGGAAACGAAATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022024.1-212s1c1
Sequence:CCGGCGCCATCATAATGAAAGTGGACTCGAGTCCACTTTCATTATGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022024.2-373s21c1
Sequence:CCGGCCTATCCTTTGTGCTTCATCTCTCGAGAGATGAAGCACAAAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022024.2-783s21c1
Sequence:CCGGACCTGTTTCTCAGAAACCAAGCTCGAGCTTGGTTTCTGAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022024.2-643s21c1
Sequence:CCGGTCAGGAACTTAATAACGACATCTCGAGATGTCGTTATTAAGTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022024.2-705s21c1
Sequence:CCGGCAGTCCCTACAGTTCCAACTTCTCGAGAAGTTGGAACTGTAGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022024.2-655s21c1
Sequence:CCGGTAACGACATGGTATCTGCAAACTCGAGTTTGCAGATACCATGTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022024
VALIDATED
GMFG MISSION shRNA shRNA Plasmid DNA
glia maturation factor, gamma
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022024.1-155s1c1
Sequence:CCGGCCCGGAGCTAAAGGAAACATTCTCGAGAATGTTTCCTTTAGCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022024.1-336s1c1
Sequence:CCGGAGCTACAAGTACGTGCATGATCTCGAGATCATGCACGTACTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022024.1-370s1c1
Sequence:CCGGCCTATCCTTTGTGCTTCATCTCTCGAGAGATGAAGCACAAAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022024.1-176s1c1
Sequence:CCGGGAGGAAATTTCGTTTCCGAAACTCGAGTTTCGGAAACGAAATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022024.1-212s1c1
Sequence:CCGGCGCCATCATAATGAAAGTGGACTCGAGTCCACTTTCATTATGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022024.2-373s21c1
Sequence:CCGGCCTATCCTTTGTGCTTCATCTCTCGAGAGATGAAGCACAAAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022024.2-783s21c1
Sequence:CCGGACCTGTTTCTCAGAAACCAAGCTCGAGCTTGGTTTCTGAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022024.2-643s21c1
Sequence:CCGGTCAGGAACTTAATAACGACATCTCGAGATGTCGTTATTAAGTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022024.2-705s21c1
Sequence:CCGGCAGTCCCTACAGTTCCAACTTCTCGAGAAGTTGGAACTGTAGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022024.2-655s21c1
Sequence:CCGGTAACGACATGGTATCTGCAAACTCGAGTTTGCAGATACCATGTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022024
VALIDATED
GMFG MISSION shRNA Lentiviral Transduction Particles
glia maturation factor, gamma
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022024.1-155s1c1
Sequence:CCGGCCCGGAGCTAAAGGAAACATTCTCGAGAATGTTTCCTTTAGCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022024.1-336s1c1
Sequence:CCGGAGCTACAAGTACGTGCATGATCTCGAGATCATGCACGTACTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022024.1-370s1c1
Sequence:CCGGCCTATCCTTTGTGCTTCATCTCTCGAGAGATGAAGCACAAAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022024.1-176s1c1
Sequence:CCGGGAGGAAATTTCGTTTCCGAAACTCGAGTTTCGGAAACGAAATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022024.1-212s1c1
Sequence:CCGGCGCCATCATAATGAAAGTGGACTCGAGTCCACTTTCATTATGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022024.2-373s21c1
Sequence:CCGGCCTATCCTTTGTGCTTCATCTCTCGAGAGATGAAGCACAAAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022024.2-783s21c1
Sequence:CCGGACCTGTTTCTCAGAAACCAAGCTCGAGCTTGGTTTCTGAGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022024.2-643s21c1
Sequence:CCGGTCAGGAACTTAATAACGACATCTCGAGATGTCGTTATTAAGTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022024.2-705s21c1
Sequence:CCGGCAGTCCCTACAGTTCCAACTTCTCGAGAAGTTGGAACTGTAGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022024.2-655s21c1
Sequence:CCGGTAACGACATGGTATCTGCAAACTCGAGTTTGCAGATACCATGTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004877
VALIDATED
GMFG MISSION shRNA Bacterial Glycerol Stock
glia maturation factor, gamma
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-241s1c1
Sequence:CCGGTGGCCGAGTGTCCTACCCTTTCTCGAGAAAGGGTAGGACACTCGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-308s1c1
Sequence:CCGGATGATGTATGCAGGGAGTAAACTCGAGTTTACTCCCTGCATACATCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-205s1c1
Sequence:CCGGGTTCGTGGTTTACAGCTACAACTCGAGTTGTAGCTGTAAACCACGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-246s1c1
Sequence:CCGGGAGTGTCCTACCCTTTGTGTTCTCGAGAACACAAAGGGTAGGACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-502s1c1
Sequence:CCGGCCTGAACAACCAAGACTTTAACTCGAGTTAAAGTCTTGGTTGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004877.2-458s21c1
Sequence:CCGGGCTCACAAAGGTGTTCGAAATCTCGAGATTTCGAACACCTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004877.2-191s21c1
Sequence:CCGGAGACAATGCAGCCATCATAATCTCGAGATTATGATGGCTGCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004877.2-302s21c1
Sequence:CCGGACAGCCCAGGTTCGTGGTTTACTCGAGTAAACCACGAACCTGGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004877
VALIDATED
GMFG MISSION shRNA shRNA Plasmid DNA
glia maturation factor, gamma
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-241s1c1
Sequence:CCGGTGGCCGAGTGTCCTACCCTTTCTCGAGAAAGGGTAGGACACTCGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-308s1c1
Sequence:CCGGATGATGTATGCAGGGAGTAAACTCGAGTTTACTCCCTGCATACATCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-205s1c1
Sequence:CCGGGTTCGTGGTTTACAGCTACAACTCGAGTTGTAGCTGTAAACCACGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-246s1c1
Sequence:CCGGGAGTGTCCTACCCTTTGTGTTCTCGAGAACACAAAGGGTAGGACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-502s1c1
Sequence:CCGGCCTGAACAACCAAGACTTTAACTCGAGTTAAAGTCTTGGTTGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004877.2-458s21c1
Sequence:CCGGGCTCACAAAGGTGTTCGAAATCTCGAGATTTCGAACACCTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004877.2-191s21c1
Sequence:CCGGAGACAATGCAGCCATCATAATCTCGAGATTATGATGGCTGCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004877.2-302s21c1
Sequence:CCGGACAGCCCAGGTTCGTGGTTTACTCGAGTAAACCACGAACCTGGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004877
VALIDATED
GMFG MISSION shRNA Lentiviral Transduction Particles
glia maturation factor, gamma
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-241s1c1
Sequence:CCGGTGGCCGAGTGTCCTACCCTTTCTCGAGAAAGGGTAGGACACTCGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-308s1c1
Sequence:CCGGATGATGTATGCAGGGAGTAAACTCGAGTTTACTCCCTGCATACATCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-205s1c1
Sequence:CCGGGTTCGTGGTTTACAGCTACAACTCGAGTTGTAGCTGTAAACCACGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-246s1c1
Sequence:CCGGGAGTGTCCTACCCTTTGTGTTCTCGAGAACACAAAGGGTAGGACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_004877.x-502s1c1
Sequence:CCGGCCTGAACAACCAAGACTTTAACTCGAGTTAAAGTCTTGGTTGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004877.2-458s21c1
Sequence:CCGGGCTCACAAAGGTGTTCGAAATCTCGAGATTTCGAACACCTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004877.2-191s21c1
Sequence:CCGGAGACAATGCAGCCATCATAATCTCGAGATTATGATGGCTGCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004877.2-302s21c1
Sequence:CCGGACAGCCCAGGTTCGTGGTTTACTCGAGTAAACCACGAACCTGGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks