EMAIL THIS PAGE TO A FRIEND

GMIP

GEM interacting protein

47 Gene Product Result for
Synonyms: ARHGAP46
UniProtKB ID: Q9P107, A0AVN9
Gene ID:
Human(51291) Summary: This gene encodes a member of the ARHGAP family of Rho/Rac/Cdc42-like GTPase activating proteins. The encoded protein interacts with the Ras-related protein Gem through its N-terminal domain. Separately, it interacts with RhoA through a RhoGAP domain, and stimulates RhoA-dependent GTPase activity. Alternatively spliced variants that encode different protein isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(78816) Gem-interacting protein
Rat(306357) Gem-interacting protein
chicken(426010) GEM interacting protein
dog(484801) GEM interacting protein
domestic cat(101101198) GEM interacting protein
Horse(100069702) GEM interacting protein
cow(533029) GEM interacting protein
sheep(101104064) GEM interacting protein
Domestic Rabbit(100343192) GEM interacting protein
domestic guinea pig(100722518) GEM interacting protein
naked mole-rat(101722577) GEM interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016573 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016573 Rosetta Predictions human pricing
NM_001107308 Rosetta Predictions rat pricing
NM_198101 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062615 predicted 1714
2 SASI_Hs01_00062616 predicted 566
3 SASI_Hs01_00062617 predicted 654
4 SASI_Hs01_00062619 predicted 3275
5 SASI_Hs01_00062620 predicted 468
6 SASI_Hs01_00062621 predicted 2132
7 SASI_Hs01_00062623 predicted 1566
8 SASI_Hs01_00062624 predicted 2114
9 SASI_Hs02_00349701 predicted 359
10 SASI_Hs02_00349702 predicted 1956
11 SASI_Hs01_00062618 predicted 3124
12 SASI_Hs01_00062622 predicted 2944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227555 predicted 1551
2 SASI_Rn02_00227556 predicted 3045
3 SASI_Rn02_00227557 predicted 547
4 SASI_Rn02_00227558 predicted 467
5 SASI_Rn02_00227559 predicted 902
6 SASI_Rn02_00227560 predicted 1353
7 SASI_Rn02_00227561 predicted 351
8 SASI_Rn02_00227562 predicted 241
9 SASI_Rn02_00227563 predicted 483
10 SASI_Rn02_00227564 predicted 2092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122493 predicted 2103
2 SASI_Mm01_00122494 predicted 1371
3 SASI_Mm01_00122495 predicted 482
4 SASI_Mm01_00122496 predicted 2239
5 SASI_Mm01_00122497 predicted 1451
6 SASI_Mm01_00122498 predicted 556
7 SASI_Mm01_00122499 predicted 2230
8 SASI_Mm01_00122500 predicted 3049
9 SASI_Mm01_00122501 predicted 2367
10 SASI_Mm01_00122502 predicted 1652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198101
VALIDATED
GMIP MISSION shRNA Bacterial Glycerol Stock
GEM interacting protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198101.1-1235s21c1
Sequence:CCGGACAGCTGTGGTGCACAGTTTCCTCGAGGAAACTGTGCACCACAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198101.1-2363s21c1
Sequence:CCGGGTGCACTATGAGCAGATCTTTCTCGAGAAAGATCTGCTCATAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198101.1-3323s21c1
Sequence:CCGGGACGGGTGTCTTGACTATTTCCTCGAGGAAATAGTCAAGACACCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198101.1-417s1c1
Sequence:CCGGCCCTGGAGTATGCTAAAGCATCTCGAGATGCTTTAGCATACTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198101.1-2035s1c1
Sequence:CCGGCGCCTTCATCTCTCTGGCAAACTCGAGTTTGCCAGAGAGATGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198101.1-571s1c1
Sequence:CCGGCCAGTACATCTACACCTTGTTCTCGAGAACAAGGTGTAGATGTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198101.1-371s1c1
Sequence:CCGGGAACTGGATTTGCGACTCATTCTCGAGAATGAGTCGCAAATCCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198101.1-2231s1c1
Sequence:CCGGGCCAACAATCTGGGAATTGTACTCGAGTACAATTCCCAGATTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198101
VALIDATED
GMIP MISSION shRNA shRNA Plasmid DNA
GEM interacting protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198101.1-1235s21c1
Sequence:CCGGACAGCTGTGGTGCACAGTTTCCTCGAGGAAACTGTGCACCACAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198101.1-2363s21c1
Sequence:CCGGGTGCACTATGAGCAGATCTTTCTCGAGAAAGATCTGCTCATAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198101.1-3323s21c1
Sequence:CCGGGACGGGTGTCTTGACTATTTCCTCGAGGAAATAGTCAAGACACCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198101.1-417s1c1
Sequence:CCGGCCCTGGAGTATGCTAAAGCATCTCGAGATGCTTTAGCATACTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198101.1-2035s1c1
Sequence:CCGGCGCCTTCATCTCTCTGGCAAACTCGAGTTTGCCAGAGAGATGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198101.1-571s1c1
Sequence:CCGGCCAGTACATCTACACCTTGTTCTCGAGAACAAGGTGTAGATGTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198101.1-371s1c1
Sequence:CCGGGAACTGGATTTGCGACTCATTCTCGAGAATGAGTCGCAAATCCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198101.1-2231s1c1
Sequence:CCGGGCCAACAATCTGGGAATTGTACTCGAGTACAATTCCCAGATTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198101
VALIDATED
GMIP MISSION shRNA Lentiviral Transduction Particles
GEM interacting protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198101.1-1235s21c1
Sequence:CCGGACAGCTGTGGTGCACAGTTTCCTCGAGGAAACTGTGCACCACAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198101.1-2363s21c1
Sequence:CCGGGTGCACTATGAGCAGATCTTTCTCGAGAAAGATCTGCTCATAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198101.1-3323s21c1
Sequence:CCGGGACGGGTGTCTTGACTATTTCCTCGAGGAAATAGTCAAGACACCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198101.1-417s1c1
Sequence:CCGGCCCTGGAGTATGCTAAAGCATCTCGAGATGCTTTAGCATACTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198101.1-2035s1c1
Sequence:CCGGCGCCTTCATCTCTCTGGCAAACTCGAGTTTGCCAGAGAGATGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198101.1-571s1c1
Sequence:CCGGCCAGTACATCTACACCTTGTTCTCGAGAACAAGGTGTAGATGTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198101.1-371s1c1
Sequence:CCGGGAACTGGATTTGCGACTCATTCTCGAGAATGAGTCGCAAATCCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198101.1-2231s1c1
Sequence:CCGGGCCAACAATCTGGGAATTGTACTCGAGTACAATTCCCAGATTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016573
VALIDATED
GMIP MISSION shRNA Bacterial Glycerol Stock
GEM interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016573.2-2369s21c1
Sequence:CCGGTGCACTACGAGCAGATCTTTGCTCGAGCAAAGATCTGCTCGTAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016573.2-3302s21c1
Sequence:CCGGTCAGGGTCAGTGCAGGTTATGCTCGAGCATAACCTGCACTGACCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016573.2-3144s21c1
Sequence:CCGGAGGTCCAGAGGGTTCCTATAACTCGAGTTATAGGAACCCTCTGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016573.2-1809s21c1
Sequence:CCGGACCCTTTGTGGTCACGAAGTGCTCGAGCACTTCGTGACCACAAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016573.2-1975s21c1
Sequence:CCGGTCGAGTGTCCTCAAGCGATTTCTCGAGAAATCGCTTGAGGACACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_016573.1-451s1c1
Sequence:CCGGGTTTGCTAAGAGCACCATGAACTCGAGTTCATGGTGCTCTTAGCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016573.1-3026s1c1
Sequence:CCGGGATTGTGAACACGGACCCATACTCGAGTATGGGTCCGTGTTCACAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_016573.1-2110s1c1
Sequence:CCGGGCTGCCTGACTCTAACTACAACTCGAGTTGTAGTTAGAGTCAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_016573.1-1207s1c1
Sequence:CCGGCCCTCTGGACATCAGAAAGAACTCGAGTTCTTTCTGATGTCCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_016573.1-523s1c1
Sequence:CCGGGCAGTACATCTACACCCTGTTCTCGAGAACAGGGTGTAGATGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016573
VALIDATED
GMIP MISSION shRNA shRNA Plasmid DNA
GEM interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016573.2-2369s21c1
Sequence:CCGGTGCACTACGAGCAGATCTTTGCTCGAGCAAAGATCTGCTCGTAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016573.2-3302s21c1
Sequence:CCGGTCAGGGTCAGTGCAGGTTATGCTCGAGCATAACCTGCACTGACCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016573.2-3144s21c1
Sequence:CCGGAGGTCCAGAGGGTTCCTATAACTCGAGTTATAGGAACCCTCTGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016573.2-1809s21c1
Sequence:CCGGACCCTTTGTGGTCACGAAGTGCTCGAGCACTTCGTGACCACAAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016573.2-1975s21c1
Sequence:CCGGTCGAGTGTCCTCAAGCGATTTCTCGAGAAATCGCTTGAGGACACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_016573.1-451s1c1
Sequence:CCGGGTTTGCTAAGAGCACCATGAACTCGAGTTCATGGTGCTCTTAGCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016573.1-3026s1c1
Sequence:CCGGGATTGTGAACACGGACCCATACTCGAGTATGGGTCCGTGTTCACAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_016573.1-2110s1c1
Sequence:CCGGGCTGCCTGACTCTAACTACAACTCGAGTTGTAGTTAGAGTCAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_016573.1-1207s1c1
Sequence:CCGGCCCTCTGGACATCAGAAAGAACTCGAGTTCTTTCTGATGTCCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_016573.1-523s1c1
Sequence:CCGGGCAGTACATCTACACCCTGTTCTCGAGAACAGGGTGTAGATGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016573
VALIDATED
GMIP MISSION shRNA Lentiviral Transduction Particles
GEM interacting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016573.2-2369s21c1
Sequence:CCGGTGCACTACGAGCAGATCTTTGCTCGAGCAAAGATCTGCTCGTAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016573.2-3302s21c1
Sequence:CCGGTCAGGGTCAGTGCAGGTTATGCTCGAGCATAACCTGCACTGACCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016573.2-3144s21c1
Sequence:CCGGAGGTCCAGAGGGTTCCTATAACTCGAGTTATAGGAACCCTCTGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016573.2-1809s21c1
Sequence:CCGGACCCTTTGTGGTCACGAAGTGCTCGAGCACTTCGTGACCACAAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016573.2-1975s21c1
Sequence:CCGGTCGAGTGTCCTCAAGCGATTTCTCGAGAAATCGCTTGAGGACACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_016573.1-451s1c1
Sequence:CCGGGTTTGCTAAGAGCACCATGAACTCGAGTTCATGGTGCTCTTAGCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016573.1-3026s1c1
Sequence:CCGGGATTGTGAACACGGACCCATACTCGAGTATGGGTCCGTGTTCACAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_016573.1-2110s1c1
Sequence:CCGGGCTGCCTGACTCTAACTACAACTCGAGTTGTAGTTAGAGTCAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_016573.1-1207s1c1
Sequence:CCGGCCCTCTGGACATCAGAAAGAACTCGAGTTCTTTCTGATGTCCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_016573.1-523s1c1
Sequence:CCGGGCAGTACATCTACACCCTGTTCTCGAGAACAGGGTGTAGATGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks