EMAIL THIS PAGE TO A FRIEND

GML

glycosylphosphatidylinositol anchored molecule like

91 Gene Product Result for
Synonyms: LY6DL
UniProtKB ID: Q99445, A0AVF6, O00686, O00731
Gene ID:
Mouse(625599) GPI anchored molecule like protein
Rat(300019) glycosylphosphatidylinositol anchored molecule like
cow(767955) glycosylphosphatidylinositol anchored molecule like protein
cow(100138533) glycosylphosphatidylinositol anchored molecule like protein-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002066 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU146191 MISSION® esiRNA esiRNA targeting mouse Gml mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002066 Rosetta Predictions human pricing
XM_001073772 Rosetta Predictions rat pricing
XM_235422 Rosetta Predictions rat pricing
XM_001475491 Rosetta Predictions mouse pricing
XM_001476885 Rosetta Predictions mouse pricing
XM_001476898 Rosetta Predictions mouse pricing
XM_890177 Rosetta Predictions mouse pricing
XM_909667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042582 predicted 196
2 SASI_Hs01_00042583 predicted 237
3 SASI_Hs02_00333135 predicted 224
4 SASI_Hs01_00042584 predicted 255
5 SASI_Hs01_00042585 predicted 385
6 SASI_Hs01_00042586 predicted 271
7 SASI_Hs01_00042587 predicted 248
8 SASI_Hs02_00333136 predicted 276
9 SASI_Hs01_00042589 predicted 453
10 SASI_Hs01_00042591 predicted 444
11 SASI_Hs01_00042588 predicted 290
12 SASI_Hs01_00042590 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343864 predicted 230
2 SASI_Rn02_00343865 predicted 205
3 SASI_Rn02_00343866 predicted 268
4 SASI_Rn02_00343867 predicted 264
5 SASI_Rn02_00343868 predicted 207
6 SASI_Rn02_00343869 predicted 229
7 SASI_Rn02_00343870 predicted 266
8 SASI_Rn02_00343871 predicted 288
9 SASI_Rn02_00343872 predicted 219
10 SASI_Rn02_00343873 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164551 predicted 324
2 SASI_Rn01_00164552 predicted 299
3 SASI_Rn01_00164553 predicted 321
4 SASI_Rn01_00164554 predicted 348
5 SASI_Rn01_00164555 predicted 220
6 SASI_Rn02_00389298 predicted 234
7 SASI_Rn01_00164556 predicted 304
8 SASI_Rn01_00164557 predicted 403
9 SASI_Rn01_00164559 predicted 247
10 SASI_Rn01_00164560 predicted 292
11 SASI_Rn01_00164558 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001475491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00382896 predicted 121
2 SASI_Mm02_00382897 predicted 175
3 SASI_Mm02_00382898 predicted 161
4 SASI_Mm02_00382899 predicted 166
5 SASI_Mm02_00382900 predicted 168
6 SASI_Mm02_00382901 predicted 170
7 SASI_Mm02_00382902 predicted 166
8 SASI_Mm02_00382903 predicted 118
9 SASI_Mm02_00382904 predicted 165
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00391966 predicted 278
2 SASI_Mm02_00391967 predicted 549
3 SASI_Mm02_00391968 predicted 392
4 SASI_Mm02_00391969 predicted 253
5 SASI_Mm02_00391970 predicted 293
6 SASI_Mm02_00391971 predicted 335
7 SASI_Mm02_00391972 predicted 535
8 SASI_Mm02_00391973 predicted 390
9 SASI_Mm02_00391974 predicted 327
10 SASI_Mm02_00391975 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00392049 predicted 116
2 SASI_Mm02_00392050 predicted 175
3 SASI_Mm02_00392051 predicted 162
4 SASI_Mm02_00392052 predicted 167
5 SASI_Mm02_00392053 predicted 162
6 SASI_Mm02_00392054 predicted 164
7 SASI_Mm02_00392055 predicted 166
8 SASI_Mm02_00392056 predicted 118
9 SASI_Mm02_00392057 predicted 169
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_890177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248958 predicted 436
2 SASI_Mm01_00248959 predicted 419
3 SASI_Mm01_00248960 predicted 447
4 SASI_Mm01_00248961 predicted 694
5 SASI_Mm01_00248962 predicted 474
6 SASI_Mm01_00248963 predicted 456
7 SASI_Mm01_00248964 predicted 726
8 SASI_Mm01_00248965 predicted 674
9 SASI_Mm01_00248966 predicted 654
10 SASI_Mm01_00248967 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434986 predicted 405
2 SASI_Mm02_00434987 predicted 405
3 SASI_Mm02_00434988 predicted 438
4 SASI_Mm02_00434989 predicted 400
5 SASI_Mm02_00434990 predicted 358
6 SASI_Mm02_00434991 predicted 411
7 SASI_Mm02_00434992 predicted 298
8 SASI_Mm02_00434993 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002066
GML MISSION shRNA Bacterial Glycerol Stock
glycosylphosphatidylinositol anchored molecule like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-234s1c1
Sequence:CCGGCCGTATCATATTAGGCGCTGTCTCGAGACAGCGCCTAATATGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-397s1c1
Sequence:CCGGGTTGTTGTAATAGCATGGTTTCTCGAGAAACCATGCTATTACAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-235s1c1
Sequence:CCGGCGTATCATATTAGGCGCTGTACTCGAGTACAGCGCCTAATATGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-270s1c1
Sequence:CCGGCGCATAAATTCTCGTGAACTACTCGAGTAGTTCACGAGAATTTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-534s1c1
Sequence:CCGGGCCTCTATCATAGTCAGCAATCTCGAGATTGCTGACTATGATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002066.1-386s1c1
Sequence:CCGGCTACTGGGTTTGTTGTTGTAACTCGAGTTACAACAACAAACCCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002066.1-249s1c1
Sequence:CCGGCGCTGTATGACAATCTCCATTCTCGAGAATGGAGATTGTCATACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002066
GML MISSION shRNA shRNA Plasmid DNA
glycosylphosphatidylinositol anchored molecule like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-234s1c1
Sequence:CCGGCCGTATCATATTAGGCGCTGTCTCGAGACAGCGCCTAATATGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-397s1c1
Sequence:CCGGGTTGTTGTAATAGCATGGTTTCTCGAGAAACCATGCTATTACAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-235s1c1
Sequence:CCGGCGTATCATATTAGGCGCTGTACTCGAGTACAGCGCCTAATATGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-270s1c1
Sequence:CCGGCGCATAAATTCTCGTGAACTACTCGAGTAGTTCACGAGAATTTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-534s1c1
Sequence:CCGGGCCTCTATCATAGTCAGCAATCTCGAGATTGCTGACTATGATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002066.1-386s1c1
Sequence:CCGGCTACTGGGTTTGTTGTTGTAACTCGAGTTACAACAACAAACCCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002066.1-249s1c1
Sequence:CCGGCGCTGTATGACAATCTCCATTCTCGAGAATGGAGATTGTCATACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002066
GML MISSION shRNA Lentiviral Transduction Particles
glycosylphosphatidylinositol anchored molecule like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-234s1c1
Sequence:CCGGCCGTATCATATTAGGCGCTGTCTCGAGACAGCGCCTAATATGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-397s1c1
Sequence:CCGGGTTGTTGTAATAGCATGGTTTCTCGAGAAACCATGCTATTACAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-235s1c1
Sequence:CCGGCGTATCATATTAGGCGCTGTACTCGAGTACAGCGCCTAATATGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-270s1c1
Sequence:CCGGCGCATAAATTCTCGTGAACTACTCGAGTAGTTCACGAGAATTTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002066.1-534s1c1
Sequence:CCGGGCCTCTATCATAGTCAGCAATCTCGAGATTGCTGACTATGATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002066.1-386s1c1
Sequence:CCGGCTACTGGGTTTGTTGTTGTAACTCGAGTTACAACAACAAACCCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002066.1-249s1c1
Sequence:CCGGCGCTGTATGACAATCTCCATTCTCGAGAATGGAGATTGTCATACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks