EMAIL THIS PAGE TO A FRIEND

GMNC

geminin coiled-coil domain containing

73 Gene Product Result for
Synonyms: GEMC1
UniProtKB ID: A6NCL1
Gene ID:
Mouse(239789) geminin coiled-coil domain containing
Rat(498102) geminin coiled-coil domain containing
chicken(100857704) geminin coiled-coil domain containing
domestic cat(101080992) geminin coiled-coil domain containing
cow(100139788) geminin coiled-coil domain containing
sheep(101104882) geminin coiled-coil domain containing
domestic guinea pig(100714978) geminin coiled-coil domain containing
naked mole-rat(101706662) geminin coiled-coil domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_002346545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_002346545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_002346545 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU184091 MISSION® esiRNA esiRNA targeting mouse Gm606 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716035 Rosetta Predictions human pricing
XM_930379 Rosetta Predictions human pricing
XM_942007 Rosetta Predictions human pricing
XM_001054677 Rosetta Predictions rat pricing
XM_573306 Rosetta Predictions rat pricing
NM_001013761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00407739 predicted 868
2 SASI_Hs02_00407740 predicted 450
3 SASI_Hs02_00407741 predicted 453
4 SASI_Hs02_00407742 predicted 524
5 SASI_Hs02_00407743 predicted 982
6 SASI_Hs02_00407744 predicted 505
7 SASI_Hs02_00407745 predicted 1049
8 SASI_Hs02_00407746 predicted 783
9 SASI_Hs02_00407747 predicted 580
10 SASI_Hs02_00407748 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249963 predicted 863
2 SASI_Hs01_00249964 predicted 446
3 SASI_Hs01_00249965 predicted 448
4 SASI_Hs01_00249966 predicted 529
5 SASI_Hs01_00249967 predicted 986
6 SASI_Hs02_00481292 predicted 508
7 SASI_Hs01_00249968 predicted 1048
8 SASI_Hs01_00249969 predicted 788
9 SASI_Hs01_00249970 predicted 579
10 SASI_Hs01_00249971 predicted 673
11 SASI_Hs01_00249972 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_942007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485213 predicted 866
2 SASI_Hs02_00485214 predicted 452
3 SASI_Hs02_00485215 predicted 455
4 SASI_Hs02_00485216 predicted 525
5 SASI_Hs02_00485217 predicted 982
6 SASI_Hs02_00485218 predicted 509
7 SASI_Hs02_00485219 predicted 1048
8 SASI_Hs02_00485220 predicted 788
9 SASI_Hs02_00485221 predicted 577
10 SASI_Hs02_00485222 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276797 predicted 354
2 SASI_Rn02_00276798 predicted 972
3 SASI_Rn02_00276799 predicted 354
4 SASI_Rn02_00276800 predicted 380
5 SASI_Rn02_00276801 predicted 612
6 SASI_Rn02_00276802 predicted 330
7 SASI_Rn02_00276803 predicted 1054
8 SASI_Rn02_00276804 predicted 724
9 SASI_Rn02_00276805 predicted 439
10 SASI_Rn02_00276806 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400152 predicted 348
2 SASI_Rn02_00400153 predicted 973
3 SASI_Rn02_00400154 predicted 348
4 SASI_Rn02_00400155 predicted 381
5 SASI_Rn02_00400156 predicted 616
6 SASI_Rn02_00400157 predicted 330
7 SASI_Rn02_00400158 predicted 1053
8 SASI_Rn02_00400159 predicted 718
9 SASI_Rn02_00400160 predicted 446
10 SASI_Rn02_00400161 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183686 predicted 400
2 SASI_Mm01_00183687 predicted 884
3 SASI_Mm01_00183688 predicted 317
4 SASI_Mm01_00183689 predicted 905
5 SASI_Mm02_00287294 predicted 1065
6 SASI_Mm01_00183690 predicted 1002
7 SASI_Mm01_00183691 predicted 294
8 SASI_Mm01_00183693 predicted 302
9 SASI_Mm01_00183694 predicted 1127
10 SASI_Mm01_00183695 predicted 622
11 SASI_Mm01_00183692 predicted 369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_002346545
GMNC MISSION shRNA Bacterial Glycerol Stock
geminin coiled-coil domain containing
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-575s21c1
Sequence:CCGGGCCACTCATGGAGAAGATTTCCTCGAGGAAATCTTCTCCATGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-698s21c1
Sequence:CCGGTCCCTGAGCCCTCATTGTAATCTCGAGATTACAATGAGGGCTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-599s21c1
Sequence:CCGGATCCTTTCTCAACTTTCAAATCTCGAGATTTGAAAGTTGAGAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-643s21c1
Sequence:CCGGTCCTTACTATACTGCTCATGTCTCGAGACATGAGCAGTATAGTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-748s21c1
Sequence:CCGGAGCCTTTGTGCGTCGAGATGACTCGAGTCATCTCGACGCACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_002346545
GMNC MISSION shRNA shRNA Plasmid DNA
geminin coiled-coil domain containing
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-575s21c1
Sequence:CCGGGCCACTCATGGAGAAGATTTCCTCGAGGAAATCTTCTCCATGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-698s21c1
Sequence:CCGGTCCCTGAGCCCTCATTGTAATCTCGAGATTACAATGAGGGCTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-599s21c1
Sequence:CCGGATCCTTTCTCAACTTTCAAATCTCGAGATTTGAAAGTTGAGAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-643s21c1
Sequence:CCGGTCCTTACTATACTGCTCATGTCTCGAGACATGAGCAGTATAGTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-748s21c1
Sequence:CCGGAGCCTTTGTGCGTCGAGATGACTCGAGTCATCTCGACGCACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_002346545
GMNC MISSION shRNA Lentiviral Transduction Particles
geminin coiled-coil domain containing
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-575s21c1
Sequence:CCGGGCCACTCATGGAGAAGATTTCCTCGAGGAAATCTTCTCCATGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-698s21c1
Sequence:CCGGTCCCTGAGCCCTCATTGTAATCTCGAGATTACAATGAGGGCTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-599s21c1
Sequence:CCGGATCCTTTCTCAACTTTCAAATCTCGAGATTTGAAAGTTGAGAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-643s21c1
Sequence:CCGGTCCTTACTATACTGCTCATGTCTCGAGACATGAGCAGTATAGTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_002346545.1-748s21c1
Sequence:CCGGAGCCTTTGTGCGTCGAGATGACTCGAGTCATCTCGACGCACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013761
GMNC MISSION shRNA Bacterial Glycerol Stock
geminin coiled-coil domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013761.1-110s21c1
Sequence:CCGGAGAGTTATAATTGCCCGTATTCTCGAGAATACGGGCAATTATAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013761.1-776s21c1
Sequence:CCGGGAGATCTACACCTCGACTATGCTCGAGCATAGTCGAGGTGTAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013761.1-2189s21c1
Sequence:CCGGATGTAGGGTGAACCTTATATACTCGAGTATATAAGGTTCACCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013761.1-244s21c1
Sequence:CCGGTCGCCCTCTGAGTTAAGTTTCCTCGAGGAAACTTAACTCAGAGGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013761.1-77s21c1
Sequence:CCGGTGCCTTGCCAAGATCAGTATTCTCGAGAATACTGATCTTGGCAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013761
GMNC MISSION shRNA shRNA Plasmid DNA
geminin coiled-coil domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013761.1-110s21c1
Sequence:CCGGAGAGTTATAATTGCCCGTATTCTCGAGAATACGGGCAATTATAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013761.1-776s21c1
Sequence:CCGGGAGATCTACACCTCGACTATGCTCGAGCATAGTCGAGGTGTAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013761.1-2189s21c1
Sequence:CCGGATGTAGGGTGAACCTTATATACTCGAGTATATAAGGTTCACCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013761.1-244s21c1
Sequence:CCGGTCGCCCTCTGAGTTAAGTTTCCTCGAGGAAACTTAACTCAGAGGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013761.1-77s21c1
Sequence:CCGGTGCCTTGCCAAGATCAGTATTCTCGAGAATACTGATCTTGGCAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013761
GMNC MISSION shRNA Lentiviral Transduction Particles
geminin coiled-coil domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013761.1-110s21c1
Sequence:CCGGAGAGTTATAATTGCCCGTATTCTCGAGAATACGGGCAATTATAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013761.1-776s21c1
Sequence:CCGGGAGATCTACACCTCGACTATGCTCGAGCATAGTCGAGGTGTAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013761.1-2189s21c1
Sequence:CCGGATGTAGGGTGAACCTTATATACTCGAGTATATAAGGTTCACCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013761.1-244s21c1
Sequence:CCGGTCGCCCTCTGAGTTAAGTTTCCTCGAGGAAACTTAACTCAGAGGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013761.1-77s21c1
Sequence:CCGGTGCCTTGCCAAGATCAGTATTCTCGAGAATACTGATCTTGGCAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks