EMAIL THIS PAGE TO A FRIEND

GMNN

geminin, DNA replication inhibitor

67 Gene Product Result for
Synonyms: Gem
UniProtKB ID: O75496, B3KMM8, Q9H1Z1
Gene ID:
Human(51053) Summary: This gene encodes a protein that plays a critical role in cell cycle regulation. The encoded protein inhibits DNA replication by binding to DNA replication factor Cdt1, preventing the incorporation of minichromosome maintenance proteins into the pre-replication complex. The encoded protein is expressed during the S and G2 phases of the cell cycle and is degraded by the anaphase-promoting complex during the metaphase-anaphase transition. Increased expression of this gene may play a role in several malignancies including colon, rectal and breast cancer. Alternatively spliced transcript variants have been observed for this gene, and two pseudogenes of this gene are located on the short arm of chromosome 16. [provided by RefSeq, Oct 2011]
Mouse(57441) geminin
Rat(291137) geminin
domestic guinea pig(100735738) geminin, DNA replication inhibitor
naked mole-rat(101719826) geminin, DNA replication inhibitor
Goat(100860987) geminin, DNA replication inhibitor
sheep(101117456) geminin, DNA replication inhibitor
Zebrafish(368320) geminin, DNA replication inhibitor
cow(526377) geminin, DNA replication inhibitor
domestic cat(101097559) geminin, DNA replication inhibitor
dog(478739) geminin, DNA replication inhibitor
chicken(421004) geminin, DNA replication inhibitor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020567 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020567 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020567 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015895 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015895 Rosetta Predictions human pricing
NM_001106112 Rosetta Predictions rat pricing
NM_020567 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144939 predicted 681
2 SASI_Hs01_00144940 predicted 432
3 SASI_Hs01_00144941 predicted 651
4 SASI_Hs01_00144942 predicted 641
5 SASI_Hs01_00144943 predicted 483
6 SASI_Hs01_00144945 predicted 951
7 SASI_Hs01_00144946 predicted 367
8 SASI_Hs01_00144947 predicted 333
9 SASI_Hs01_00144948 predicted 737
10 SASI_Hs02_00348485 predicted 836
11 SASI_Hs01_00144944 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215742 predicted 778
2 SASI_Rn02_00215743 predicted 653
3 SASI_Rn02_00215744 predicted 817
4 SASI_Rn02_00215745 predicted 911
5 SASI_Rn02_00215746 predicted 752
6 SASI_Rn02_00215747 predicted 513
7 SASI_Rn02_00215748 predicted 677
8 SASI_Rn02_00215749 predicted 723
9 SASI_Rn02_00215750 predicted 588
10 SASI_Rn02_00215751 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325613 predicted 390
2 SASI_Mm02_00325614 predicted 459
3 SASI_Mm01_00100304 predicted 626
4 SASI_Mm02_00325615 predicted 294
5 SASI_Mm02_00325616 predicted 390
6 SASI_Mm02_00325617 predicted 591
7 SASI_Mm01_00100305 predicted 726
8 SASI_Mm02_00325618 predicted 566
9 SASI_Mm01_00100307 predicted 532
10 SASI_Mm01_00100308 predicted 437
11 SASI_Mm01_00100306 predicted 526
12 SASI_Mm01_00100309 predicted 662
13 SASI_Mm01_00100310 predicted 386
14 SASI_Mm01_00100311 predicted 364
15 SASI_Mm01_00100312 predicted 358
16 SASI_Mm01_00100313 predicted 526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020567
VALIDATED
GMNN MISSION shRNA Bacterial Glycerol Stock
geminin, DNA replication inhibitor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-822s21c1
Sequence:CCGGGCTGGAAGCCAGGTTTGAATCCTCGAGGATTCAAACCTGGCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-460s21c1
Sequence:CCGGGCGCTGAAAGAGAATGAGAAACTCGAGTTTCTCATTCTCTTTCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-567s21c1
Sequence:CCGGGCAGTACATGGCGGAGGTAATCTCGAGATTACCTCCGCCATGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-376s21c1
Sequence:CCGGGCCTTTGATCTTATAAGTAAACTCGAGTTTACTTATAAGATCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-602s21c1
Sequence:CCGGATGAACCTCTGGATAACTTTGCTCGAGCAAAGTTATCCAGAGGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020567.1-927s1c1
Sequence:CCGGCCTTTAGTATAGCTCTTGGTACTCGAGTACCAAGAGCTATACTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020567.1-775s1c1
Sequence:CCGGCCGGATAGTCAGGAATTTGATCTCGAGATCAAATTCCTGACTATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020567.1-665s1c1
Sequence:CCGGCCCGCCTGAGAAAGGAGAATACTCGAGTATTCTCCTTTCTCAGGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020567.1-607s1c1
Sequence:CCGGGCGCTGAAAGAGAATGAGAAACTCGAGTTTCTCATTCTCTTTCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020567.1-667s1c1
Sequence:CCGGCGCCTGAGAAAGGAGAATAAACTCGAGTTTATTCTCCTTTCTCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020567
VALIDATED
GMNN MISSION shRNA shRNA Plasmid DNA
geminin, DNA replication inhibitor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-822s21c1
Sequence:CCGGGCTGGAAGCCAGGTTTGAATCCTCGAGGATTCAAACCTGGCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-460s21c1
Sequence:CCGGGCGCTGAAAGAGAATGAGAAACTCGAGTTTCTCATTCTCTTTCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-567s21c1
Sequence:CCGGGCAGTACATGGCGGAGGTAATCTCGAGATTACCTCCGCCATGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-376s21c1
Sequence:CCGGGCCTTTGATCTTATAAGTAAACTCGAGTTTACTTATAAGATCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-602s21c1
Sequence:CCGGATGAACCTCTGGATAACTTTGCTCGAGCAAAGTTATCCAGAGGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020567.1-927s1c1
Sequence:CCGGCCTTTAGTATAGCTCTTGGTACTCGAGTACCAAGAGCTATACTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020567.1-775s1c1
Sequence:CCGGCCGGATAGTCAGGAATTTGATCTCGAGATCAAATTCCTGACTATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020567.1-665s1c1
Sequence:CCGGCCCGCCTGAGAAAGGAGAATACTCGAGTATTCTCCTTTCTCAGGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020567.1-607s1c1
Sequence:CCGGGCGCTGAAAGAGAATGAGAAACTCGAGTTTCTCATTCTCTTTCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020567.1-667s1c1
Sequence:CCGGCGCCTGAGAAAGGAGAATAAACTCGAGTTTATTCTCCTTTCTCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020567
VALIDATED
GMNN MISSION shRNA Lentiviral Transduction Particles
geminin, DNA replication inhibitor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-822s21c1
Sequence:CCGGGCTGGAAGCCAGGTTTGAATCCTCGAGGATTCAAACCTGGCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-460s21c1
Sequence:CCGGGCGCTGAAAGAGAATGAGAAACTCGAGTTTCTCATTCTCTTTCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-567s21c1
Sequence:CCGGGCAGTACATGGCGGAGGTAATCTCGAGATTACCTCCGCCATGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-376s21c1
Sequence:CCGGGCCTTTGATCTTATAAGTAAACTCGAGTTTACTTATAAGATCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020567.2-602s21c1
Sequence:CCGGATGAACCTCTGGATAACTTTGCTCGAGCAAAGTTATCCAGAGGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020567.1-927s1c1
Sequence:CCGGCCTTTAGTATAGCTCTTGGTACTCGAGTACCAAGAGCTATACTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020567.1-775s1c1
Sequence:CCGGCCGGATAGTCAGGAATTTGATCTCGAGATCAAATTCCTGACTATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020567.1-665s1c1
Sequence:CCGGCCCGCCTGAGAAAGGAGAATACTCGAGTATTCTCCTTTCTCAGGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020567.1-607s1c1
Sequence:CCGGGCGCTGAAAGAGAATGAGAAACTCGAGTTTCTCATTCTCTTTCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020567.1-667s1c1
Sequence:CCGGCGCCTGAGAAAGGAGAATAAACTCGAGTTTATTCTCCTTTCTCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015895
VALIDATED
GMNN MISSION shRNA Bacterial Glycerol Stock
geminin, DNA replication inhibitor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015895.3-765s1c1
Sequence:CCGGTAGCAGAACATGTACAGTATACTCGAGTATACTGTACATGTTCTGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015895.3-490s1c1
Sequence:CCGGACATCGGAATGACCACTTAACCTCGAGGTTAAGTGGTCATTCCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015895.3-791s1c1
Sequence:CCGGGAGCTAATAGAGAGACTGAATCTCGAGATTCAGTCTCTCTATTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015895.3-1019s1c1
Sequence:CCGGGTTCTTTGTAGCAGAGTACATCTCGAGATGTACTCTGCTACAAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015895.3-1016s1c1
Sequence:CCGGCTAGTTCTTTGTAGCAGAGTACTCGAGTACTCTGCTACAAAGAACTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-580s1c1
Sequence:CCGGCCAGGAGTCATTTGATCTTATCTCGAGATAAGATCAAATGACTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-939s1c1
Sequence:CCGGCTACGGATGCAAAGCCATGTACTCGAGTACATGGCTTTGCATCCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-1029s1c1
Sequence:CCGGGCAGAGTACATAACTACATAACTCGAGTTATGTAGTTATGTACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-839s1c1
Sequence:CCGGCTGGATAATCAGGAATTTGATCTCGAGATCAAATTCCTGATTATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-384s1c1
Sequence:CCGGAGAATAGTTCTGTCCCAAGAACTCGAGTTCTTGGGACAGAACTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015895
VALIDATED
GMNN MISSION shRNA shRNA Plasmid DNA
geminin, DNA replication inhibitor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015895.3-765s1c1
Sequence:CCGGTAGCAGAACATGTACAGTATACTCGAGTATACTGTACATGTTCTGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015895.3-490s1c1
Sequence:CCGGACATCGGAATGACCACTTAACCTCGAGGTTAAGTGGTCATTCCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015895.3-791s1c1
Sequence:CCGGGAGCTAATAGAGAGACTGAATCTCGAGATTCAGTCTCTCTATTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015895.3-1019s1c1
Sequence:CCGGGTTCTTTGTAGCAGAGTACATCTCGAGATGTACTCTGCTACAAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015895.3-1016s1c1
Sequence:CCGGCTAGTTCTTTGTAGCAGAGTACTCGAGTACTCTGCTACAAAGAACTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-580s1c1
Sequence:CCGGCCAGGAGTCATTTGATCTTATCTCGAGATAAGATCAAATGACTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-939s1c1
Sequence:CCGGCTACGGATGCAAAGCCATGTACTCGAGTACATGGCTTTGCATCCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-1029s1c1
Sequence:CCGGGCAGAGTACATAACTACATAACTCGAGTTATGTAGTTATGTACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-839s1c1
Sequence:CCGGCTGGATAATCAGGAATTTGATCTCGAGATCAAATTCCTGATTATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-384s1c1
Sequence:CCGGAGAATAGTTCTGTCCCAAGAACTCGAGTTCTTGGGACAGAACTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015895
VALIDATED
GMNN MISSION shRNA Lentiviral Transduction Particles
geminin, DNA replication inhibitor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015895.3-765s1c1
Sequence:CCGGTAGCAGAACATGTACAGTATACTCGAGTATACTGTACATGTTCTGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015895.3-490s1c1
Sequence:CCGGACATCGGAATGACCACTTAACCTCGAGGTTAAGTGGTCATTCCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015895.3-791s1c1
Sequence:CCGGGAGCTAATAGAGAGACTGAATCTCGAGATTCAGTCTCTCTATTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015895.3-1019s1c1
Sequence:CCGGGTTCTTTGTAGCAGAGTACATCTCGAGATGTACTCTGCTACAAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015895.3-1016s1c1
Sequence:CCGGCTAGTTCTTTGTAGCAGAGTACTCGAGTACTCTGCTACAAAGAACTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-580s1c1
Sequence:CCGGCCAGGAGTCATTTGATCTTATCTCGAGATAAGATCAAATGACTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-939s1c1
Sequence:CCGGCTACGGATGCAAAGCCATGTACTCGAGTACATGGCTTTGCATCCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-1029s1c1
Sequence:CCGGGCAGAGTACATAACTACATAACTCGAGTTATGTAGTTATGTACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-839s1c1
Sequence:CCGGCTGGATAATCAGGAATTTGATCTCGAGATCAAATTCCTGATTATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015895.3-384s1c1
Sequence:CCGGAGAATAGTTCTGTCCCAAGAACTCGAGTTCTTGGGACAGAACTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)