EMAIL THIS PAGE TO A FRIEND

GMPPA

GDP-mannose pyrophosphorylase A

101 Gene Product Result for
Gene ID:
Human(29926) Summary: This gene is thought to encode a GDP-mannose pyrophosphorylase. This enzyme catalyzes the reaction which converts mannose-1-phosphate and GTP to GDP-mannose which is involved in the production of N-linked oligosaccharides. [provided by RefSeq, Jul 2008]
Mouse(69080) GDP-mannose pyrophosphorylase A
Rat(501167) GDP-mannose pyrophosphorylase A
chicken(769292) GDP-mannose pyrophosphorylase A
cow(504889) GDP-mannose pyrophosphorylase A
domestic cat(101097268) GDP-mannose pyrophosphorylase A
dog(608751) GDP-mannose pyrophosphorylase A
sheep(101117823) GDP-mannose pyrophosphorylase A
domestic guinea pig(100732912) GDP-mannose pyrophosphorylase A
naked mole-rat(101713073) GDP-mannose pyrophosphorylase A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013335 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133708 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133708 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133708 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013335 Rosetta Predictions human pricing
NM_205847 Rosetta Predictions human pricing
NM_001025056 Rosetta Predictions rat pricing
NM_133708 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127376 predicted 1253
2 SASI_Hs01_00127377 predicted 644
3 SASI_Hs01_00127378 predicted 764
4 SASI_Hs01_00127379 predicted 520
5 SASI_Hs01_00127382 predicted 1297
6 SASI_Hs01_00127384 predicted 629
7 SASI_Hs02_00344646 predicted 794
8 SASI_Hs02_00344647 predicted 1170
9 SASI_Hs02_00344648 predicted 714
10 SASI_Hs02_00344649 predicted 542
11 SASI_Hs01_00127375 predicted 915
12 SASI_Hs01_00127380 predicted 1289
13 SASI_Hs01_00127381 predicted 1271
14 SASI_Hs01_00127383 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073814 predicted 1543
2 SASI_Hs01_00073815 predicted 941
3 SASI_Hs01_00073816 predicted 1061
4 SASI_Hs01_00073817 predicted 814
5 SASI_Hs01_00073820 predicted 1590
6 SASI_Hs01_00073822 predicted 926
7 SASI_Hs02_00373474 predicted 1090
8 SASI_Hs02_00373475 predicted 1468
9 SASI_Hs02_00373476 predicted 1011
10 SASI_Hs02_00373477 predicted 844
11 SASI_Hs01_00073813 predicted 1219
12 SASI_Hs01_00073818 predicted 1585
13 SASI_Hs01_00073819 predicted 1569
14 SASI_Hs01_00073821 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107021 predicted 710
2 SASI_Rn01_00107022 predicted 722
3 SASI_Rn01_00107023 predicted 571
4 SASI_Rn01_00107024 predicted 312
5 SASI_Rn01_00107025 predicted 778
6 SASI_Rn01_00107026 predicted 309
7 SASI_Rn01_00107027 predicted 1050
8 SASI_Rn01_00107028 predicted 314
9 SASI_Rn01_00107029 predicted 1408
10 SASI_Rn01_00107030 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025471 predicted 568
2 SASI_Mm01_00025472 predicted 834
3 SASI_Mm01_00025473 predicted 931
4 SASI_Mm01_00025476 predicted 656
5 SASI_Mm01_00025477 predicted 931
6 SASI_Mm01_00025478 predicted 325
7 SASI_Mm01_00025479 predicted 542
8 SASI_Mm02_00338679 predicted 922
9 SASI_Mm02_00338680 predicted 1207
10 SASI_Mm02_00338681 predicted 403
11 SASI_Mm01_00025470 predicted 1160
12 SASI_Mm01_00025474 predicted 1259
13 SASI_Mm01_00025475 predicted 775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013335
VALIDATED
GMPPA MISSION shRNA Bacterial Glycerol Stock
GDP-mannose pyrophosphorylase A
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013335.2-285s1c1
Sequence:CCGGCAGCAGGAGTTTAACCTTCCACTCGAGTGGAAGGTTAAACTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013335.2-769s1c1
Sequence:CCGGGCCAGATATACGTGCATCTCACTCGAGTGAGATGCACGTATATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013335.2-306s1c1
Sequence:CCGGGTCAGGTACCTGCAGGAATTTCTCGAGAAATTCCTGCAGGTACCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_013335.2-599s1c1
Sequence:CCGGCATCATCAACTGCGGCATCTACTCGAGTAGATGCCGCAGTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013335.2-168s1c1
Sequence:CCGGGTCCCTATGATCCAACACCATCTCGAGATGGTGTTGGATCATAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013335.2-287s1c1
Sequence:CCGGGCAGGAGTTTAACCTTCCAGTCTCGAGACTGGAAGGTTAAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013335.2-1271s1c1
Sequence:CCGGCTCGATTGTTCTGCCACACAACTCGAGTTGTGTGGCAGAACAATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_013335.2-779s1c1
Sequence:CCGGCGTGCATCTCACTGATGGTATCTCGAGATACCATCAGTGAGATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_013335.2-581s1c1
Sequence:CCGGCAGCACATTTATCAGTGACATCTCGAGATGTCACTGATAAATGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013335.2-542s21c1
Sequence:CCGGTCCACAGACACACGAGGTATTCTCGAGAATACCTCGTGTGTCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013335.2-494s21c1
Sequence:CCGGTACGGCTAACAGGACGCAATCCTCGAGGATTGCGTCCTGTTAGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013335.2-651s21c1
Sequence:CCGGCGGGATGTCTTCCAGCGTAATCTCGAGATTACGCTGGAAGACATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013335.2-769s21c1
Sequence:CCGGGCCAGATATACGTGCATCTCACTCGAGTGAGATGCACGTATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013335.2-599s21c1
Sequence:CCGGCATCATCAACTGCGGCATCTACTCGAGTAGATGCCGCAGTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013335
VALIDATED
GMPPA MISSION shRNA shRNA Plasmid DNA
GDP-mannose pyrophosphorylase A
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013335.2-285s1c1
Sequence:CCGGCAGCAGGAGTTTAACCTTCCACTCGAGTGGAAGGTTAAACTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013335.2-769s1c1
Sequence:CCGGGCCAGATATACGTGCATCTCACTCGAGTGAGATGCACGTATATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013335.2-306s1c1
Sequence:CCGGGTCAGGTACCTGCAGGAATTTCTCGAGAAATTCCTGCAGGTACCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_013335.2-599s1c1
Sequence:CCGGCATCATCAACTGCGGCATCTACTCGAGTAGATGCCGCAGTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013335.2-168s1c1
Sequence:CCGGGTCCCTATGATCCAACACCATCTCGAGATGGTGTTGGATCATAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013335.2-287s1c1
Sequence:CCGGGCAGGAGTTTAACCTTCCAGTCTCGAGACTGGAAGGTTAAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013335.2-1271s1c1
Sequence:CCGGCTCGATTGTTCTGCCACACAACTCGAGTTGTGTGGCAGAACAATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_013335.2-779s1c1
Sequence:CCGGCGTGCATCTCACTGATGGTATCTCGAGATACCATCAGTGAGATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_013335.2-581s1c1
Sequence:CCGGCAGCACATTTATCAGTGACATCTCGAGATGTCACTGATAAATGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013335.2-542s21c1
Sequence:CCGGTCCACAGACACACGAGGTATTCTCGAGAATACCTCGTGTGTCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013335.2-494s21c1
Sequence:CCGGTACGGCTAACAGGACGCAATCCTCGAGGATTGCGTCCTGTTAGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013335.2-651s21c1
Sequence:CCGGCGGGATGTCTTCCAGCGTAATCTCGAGATTACGCTGGAAGACATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013335.2-769s21c1
Sequence:CCGGGCCAGATATACGTGCATCTCACTCGAGTGAGATGCACGTATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013335.2-599s21c1
Sequence:CCGGCATCATCAACTGCGGCATCTACTCGAGTAGATGCCGCAGTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013335
VALIDATED
GMPPA MISSION shRNA Lentiviral Transduction Particles
GDP-mannose pyrophosphorylase A
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013335.2-285s1c1
Sequence:CCGGCAGCAGGAGTTTAACCTTCCACTCGAGTGGAAGGTTAAACTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013335.2-769s1c1
Sequence:CCGGGCCAGATATACGTGCATCTCACTCGAGTGAGATGCACGTATATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013335.2-306s1c1
Sequence:CCGGGTCAGGTACCTGCAGGAATTTCTCGAGAAATTCCTGCAGGTACCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_013335.2-599s1c1
Sequence:CCGGCATCATCAACTGCGGCATCTACTCGAGTAGATGCCGCAGTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013335.2-168s1c1
Sequence:CCGGGTCCCTATGATCCAACACCATCTCGAGATGGTGTTGGATCATAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013335.2-287s1c1
Sequence:CCGGGCAGGAGTTTAACCTTCCAGTCTCGAGACTGGAAGGTTAAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013335.2-1271s1c1
Sequence:CCGGCTCGATTGTTCTGCCACACAACTCGAGTTGTGTGGCAGAACAATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_013335.2-779s1c1
Sequence:CCGGCGTGCATCTCACTGATGGTATCTCGAGATACCATCAGTGAGATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_013335.2-581s1c1
Sequence:CCGGCAGCACATTTATCAGTGACATCTCGAGATGTCACTGATAAATGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013335.2-542s21c1
Sequence:CCGGTCCACAGACACACGAGGTATTCTCGAGAATACCTCGTGTGTCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013335.2-494s21c1
Sequence:CCGGTACGGCTAACAGGACGCAATCCTCGAGGATTGCGTCCTGTTAGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013335.2-651s21c1
Sequence:CCGGCGGGATGTCTTCCAGCGTAATCTCGAGATTACGCTGGAAGACATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013335.2-769s21c1
Sequence:CCGGGCCAGATATACGTGCATCTCACTCGAGTGAGATGCACGTATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013335.2-599s21c1
Sequence:CCGGCATCATCAACTGCGGCATCTACTCGAGTAGATGCCGCAGTTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133708
VALIDATED
GMPPA MISSION shRNA Bacterial Glycerol Stock
GDP-mannose pyrophosphorylase A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133708.1-1341s1c1
Sequence:CCGGCCGCCCACACTCCTTTGGGCTCTCGAGAGCCCAAAGGAGTGTGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133708.1-1276s1c1
Sequence:CCGGGCTAAGTCGAAGCTTCACCAACTCGAGTTGGTGAAGCTTCGACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133708.1-484s1c1
Sequence:CCGGCAGGACACAATCCCTCAACTACTCGAGTAGTTGAGGGATTGTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133708.1-152s1c1
Sequence:CCGGCCCATGATCCAGCACCATATACTCGAGTATATGGTGCTGGATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133708.1-890s1c1
Sequence:CCGGCCACGCATCAGAGGAAATGTTCTCGAGAACATTTCCTCTGATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133708.3-525s21c2
Sequence:CCGGCAGGACACAATCCCTCAACTACTCGAGTAGTTGAGGGATTGTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133708.3-1382s21c1
Sequence:CCGGCCGCCCACACTCCTTTGGGCTCTCGAGAGCCCAAAGGAGTGTGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133708.3-193s21c3
Sequence:CCGGCCCATGATCCAGCACCATATACTCGAGTATATGGTGCTGGATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133708.3-1317s21c1
Sequence:CCGGGCTAAGTCGAAGCTTCACCAACTCGAGTTGGTGAAGCTTCGACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133708.3-931s21c2
Sequence:CCGGCCACGCATCAGAGGAAATGTTCTCGAGAACATTTCCTCTGATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133708
VALIDATED
GMPPA MISSION shRNA shRNA Plasmid DNA
GDP-mannose pyrophosphorylase A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133708.1-1341s1c1
Sequence:CCGGCCGCCCACACTCCTTTGGGCTCTCGAGAGCCCAAAGGAGTGTGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133708.1-1276s1c1
Sequence:CCGGGCTAAGTCGAAGCTTCACCAACTCGAGTTGGTGAAGCTTCGACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133708.1-484s1c1
Sequence:CCGGCAGGACACAATCCCTCAACTACTCGAGTAGTTGAGGGATTGTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133708.1-152s1c1
Sequence:CCGGCCCATGATCCAGCACCATATACTCGAGTATATGGTGCTGGATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133708.1-890s1c1
Sequence:CCGGCCACGCATCAGAGGAAATGTTCTCGAGAACATTTCCTCTGATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133708.3-525s21c2
Sequence:CCGGCAGGACACAATCCCTCAACTACTCGAGTAGTTGAGGGATTGTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133708.3-1382s21c1
Sequence:CCGGCCGCCCACACTCCTTTGGGCTCTCGAGAGCCCAAAGGAGTGTGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133708.3-193s21c3
Sequence:CCGGCCCATGATCCAGCACCATATACTCGAGTATATGGTGCTGGATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133708.3-1317s21c1
Sequence:CCGGGCTAAGTCGAAGCTTCACCAACTCGAGTTGGTGAAGCTTCGACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133708.3-931s21c2
Sequence:CCGGCCACGCATCAGAGGAAATGTTCTCGAGAACATTTCCTCTGATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133708
VALIDATED
GMPPA MISSION shRNA Lentiviral Transduction Particles
GDP-mannose pyrophosphorylase A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133708.1-1341s1c1
Sequence:CCGGCCGCCCACACTCCTTTGGGCTCTCGAGAGCCCAAAGGAGTGTGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133708.1-1276s1c1
Sequence:CCGGGCTAAGTCGAAGCTTCACCAACTCGAGTTGGTGAAGCTTCGACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133708.1-484s1c1
Sequence:CCGGCAGGACACAATCCCTCAACTACTCGAGTAGTTGAGGGATTGTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133708.1-152s1c1
Sequence:CCGGCCCATGATCCAGCACCATATACTCGAGTATATGGTGCTGGATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133708.1-890s1c1
Sequence:CCGGCCACGCATCAGAGGAAATGTTCTCGAGAACATTTCCTCTGATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133708.3-525s21c2
Sequence:CCGGCAGGACACAATCCCTCAACTACTCGAGTAGTTGAGGGATTGTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133708.3-1382s21c1
Sequence:CCGGCCGCCCACACTCCTTTGGGCTCTCGAGAGCCCAAAGGAGTGTGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133708.3-193s21c3
Sequence:CCGGCCCATGATCCAGCACCATATACTCGAGTATATGGTGCTGGATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133708.3-1317s21c1
Sequence:CCGGGCTAAGTCGAAGCTTCACCAACTCGAGTTGGTGAAGCTTCGACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133708.3-931s21c2
Sequence:CCGGCCACGCATCAGAGGAAATGTTCTCGAGAACATTTCCTCTGATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks