EMAIL THIS PAGE TO A FRIEND

GMPPB

GDP-mannose pyrophosphorylase B

79 Gene Product Result for
Synonyms: MDDGA14 MDDGB14 MDDGC14
UniProtKB ID: Q9Y5P6, A8K6N5, Q9H7U3
Gene ID:
Human(29925) Summary: This gene is thought to encode a GDP-mannose pyrophosphorylase. The encoded protein catalyzes the conversion of mannose-1-phosphate and GTP to GDP-mannose, a reaction involved in the production of N-linked oligosaccharides. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2009]
Mouse(331026) GDP-mannose pyrophosphorylase B
Rat(363145) GDP-mannose pyrophosphorylase B
Zebrafish(445097) GDP-mannose pyrophosphorylase B
cow(514161) GDP-mannose pyrophosphorylase B
domestic cat(101086635) GDP-mannose pyrophosphorylase B
dog(100856660) GDP-mannose pyrophosphorylase B
chicken(415924) GDP-mannose pyrophosphorylase B
domestic guinea pig(100735495) GDP-mannose pyrophosphorylase B
naked mole-rat(101716745) GDP-mannose pyrophosphorylase B
sheep(101102764) GDP-mannose pyrophosphorylase B
Domestic Rabbit(100357646) GDP-mannose pyrophosphorylase B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013334 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177910 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177910 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177910 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013334 Rosetta Predictions human pricing
NM_021971 Rosetta Predictions human pricing
NM_001108781 Rosetta Predictions rat pricing
NM_177910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173736 predicted 682
2 SASI_Hs01_00173737 predicted 704
3 SASI_Hs01_00173740 predicted 787
4 SASI_Hs01_00173741 predicted 902
5 SASI_Hs01_00173742 predicted 437
6 SASI_Hs01_00173743 predicted 854
7 SASI_Hs01_00173744 predicted 837
8 SASI_Hs01_00173745 predicted 641
9 SASI_Hs02_00344644 predicted 891
10 SASI_Hs02_00344645 predicted 310
11 SASI_Hs01_00173738 predicted 441
12 SASI_Hs01_00173739 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144629 predicted 682
2 SASI_Hs01_00144630 predicted 706
3 SASI_Hs01_00144633 predicted 785
4 SASI_Hs01_00144634 predicted 906
5 SASI_Hs01_00144635 predicted 443
6 SASI_Hs01_00144636 predicted 851
7 SASI_Hs01_00144637 predicted 841
8 SASI_Hs01_00144638 predicted 640
9 SASI_Hs02_00355325 predicted 893
10 SASI_Hs02_00355326 predicted 303
11 SASI_Hs01_00144631 predicted 438
12 SASI_Hs01_00144632 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242015 predicted 1291
2 SASI_Rn02_00242016 predicted 1305
3 SASI_Rn02_00242017 predicted 432
4 SASI_Rn02_00242018 predicted 527
5 SASI_Rn02_00242019 predicted 954
6 SASI_Rn02_00242020 predicted 295
7 SASI_Rn02_00242021 predicted 230
8 SASI_Rn02_00242022 predicted 1335
9 SASI_Rn02_00242023 predicted 1295
10 SASI_Rn02_00242024 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030439 predicted 644
2 SASI_Mm01_00030440 predicted 1305
3 SASI_Mm01_00030441 predicted 954
4 SASI_Mm01_00030442 predicted 1279
5 SASI_Mm01_00030444 predicted 317
6 SASI_Mm01_00030445 predicted 880
7 SASI_Mm01_00030446 predicted 305
8 SASI_Mm02_00348393 predicted 1382
9 SASI_Mm01_00030447 predicted 227
10 SASI_Mm02_00348394 predicted 288
11 SASI_Mm01_00030443 predicted 424
12 SASI_Mm01_00030448 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013334
VALIDATED
GMPPB MISSION shRNA Bacterial Glycerol Stock
GDP-mannose pyrophosphorylase B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013334.2-1284s21c1
Sequence:CCGGGGGTGAGGACGTCATAGTTAACTCGAGTTAACTATGACGTCCTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013334.2-863s21c1
Sequence:CCGGAGGGCTTCTGGATGGACATTGCTCGAGCAATGTCCATCCAGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013334.2-1464s21c1
Sequence:CCGGCCCTGGACTTGTCATTATTTGCTCGAGCAAATAATGACAAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013334.2-549s21c1
Sequence:CCGGCAGTGACGTGATCTGCGATTTCTCGAGAAATCGCAGATCACGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013334.2-298s21c1
Sequence:CCGGCTGGTGGACTTCTGCAATAAGCTCGAGCTTATTGCAGAAGTCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013334.2-840s1c1
Sequence:CCGGGCAGCTATATGCCATGGAGTTCTCGAGAACTCCATGGCATATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013334.2-1462s1c1
Sequence:CCGGGACCCTGGACTTGTCATTATTCTCGAGAATAATGACAAGTCCAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013334
VALIDATED
GMPPB MISSION shRNA shRNA Plasmid DNA
GDP-mannose pyrophosphorylase B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013334.2-1284s21c1
Sequence:CCGGGGGTGAGGACGTCATAGTTAACTCGAGTTAACTATGACGTCCTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013334.2-863s21c1
Sequence:CCGGAGGGCTTCTGGATGGACATTGCTCGAGCAATGTCCATCCAGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013334.2-1464s21c1
Sequence:CCGGCCCTGGACTTGTCATTATTTGCTCGAGCAAATAATGACAAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013334.2-549s21c1
Sequence:CCGGCAGTGACGTGATCTGCGATTTCTCGAGAAATCGCAGATCACGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013334.2-298s21c1
Sequence:CCGGCTGGTGGACTTCTGCAATAAGCTCGAGCTTATTGCAGAAGTCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013334.2-840s1c1
Sequence:CCGGGCAGCTATATGCCATGGAGTTCTCGAGAACTCCATGGCATATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013334.2-1462s1c1
Sequence:CCGGGACCCTGGACTTGTCATTATTCTCGAGAATAATGACAAGTCCAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013334
VALIDATED
GMPPB MISSION shRNA Lentiviral Transduction Particles
GDP-mannose pyrophosphorylase B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013334.2-1284s21c1
Sequence:CCGGGGGTGAGGACGTCATAGTTAACTCGAGTTAACTATGACGTCCTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013334.2-863s21c1
Sequence:CCGGAGGGCTTCTGGATGGACATTGCTCGAGCAATGTCCATCCAGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013334.2-1464s21c1
Sequence:CCGGCCCTGGACTTGTCATTATTTGCTCGAGCAAATAATGACAAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013334.2-549s21c1
Sequence:CCGGCAGTGACGTGATCTGCGATTTCTCGAGAAATCGCAGATCACGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013334.2-298s21c1
Sequence:CCGGCTGGTGGACTTCTGCAATAAGCTCGAGCTTATTGCAGAAGTCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013334.2-840s1c1
Sequence:CCGGGCAGCTATATGCCATGGAGTTCTCGAGAACTCCATGGCATATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013334.2-1462s1c1
Sequence:CCGGGACCCTGGACTTGTCATTATTCTCGAGAATAATGACAAGTCCAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177910
VALIDATED
GMPPB MISSION shRNA Bacterial Glycerol Stock
GDP-mannose pyrophosphorylase B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000111400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177910.2-1359s1c1
Sequence:CCGGGCCCTGGACTTGGTGCCATTTCTCGAGAAATGGCACCAAGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177910.2-1264s1c1
Sequence:CCGGCAGTACCAGAACCTCGTATTACTCGAGTAATACGAGGTTCTGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177910.2-776s1c1
Sequence:CCGGGCCTACATCCATTGAGAAGGACTCGAGTCCTTCTCAATGGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177910.2-773s1c1
Sequence:CCGGGAAGCCTACATCCATTGAGAACTCGAGTTCTCAATGGATGTAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177910
VALIDATED
GMPPB MISSION shRNA shRNA Plasmid DNA
GDP-mannose pyrophosphorylase B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000111400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177910.2-1359s1c1
Sequence:CCGGGCCCTGGACTTGGTGCCATTTCTCGAGAAATGGCACCAAGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177910.2-1264s1c1
Sequence:CCGGCAGTACCAGAACCTCGTATTACTCGAGTAATACGAGGTTCTGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177910.2-776s1c1
Sequence:CCGGGCCTACATCCATTGAGAAGGACTCGAGTCCTTCTCAATGGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177910.2-773s1c1
Sequence:CCGGGAAGCCTACATCCATTGAGAACTCGAGTTCTCAATGGATGTAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177910
VALIDATED
GMPPB MISSION shRNA Lentiviral Transduction Particles
GDP-mannose pyrophosphorylase B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000111400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177910.2-1359s1c1
Sequence:CCGGGCCCTGGACTTGGTGCCATTTCTCGAGAAATGGCACCAAGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177910.2-1264s1c1
Sequence:CCGGCAGTACCAGAACCTCGTATTACTCGAGTAATACGAGGTTCTGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177910.2-776s1c1
Sequence:CCGGGCCTACATCCATTGAGAAGGACTCGAGTCCTTCTCAATGGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177910.2-773s1c1
Sequence:CCGGGAAGCCTACATCCATTGAGAACTCGAGTTCTCAATGGATGTAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks