EMAIL THIS PAGE TO A FRIEND

GMPR2

guanosine monophosphate reductase 2

99 Gene Product Result for
UniProtKB ID: Q9P2T1, D3DS66, Q567T0, Q6IAJ8
Gene ID:
Mouse(105446) guanosine monophosphate reductase 2
Rat(192357) guanosine monophosphate reductase 2
Zebrafish(678545) guanosine monophosphate reductase 2
cow(515837) guanosine monophosphate reductase 2
domestic cat(101081554) guanosine monophosphate reductase 2
Horse(100054670) guanosine monophosphate reductase 2
dog(480266) guanosine monophosphate reductase 2
domestic guinea pig(100728263) guanosine monophosphate reductase 2
naked mole-rat(101698819) guanosine monophosphate reductase 2
sheep(101114524) guanosine monophosphate reductase 2
Domestic Rabbit(100345192) guanosine monophosphate reductase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134075 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134075 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134075 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016576 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177992 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177992 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177992 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002000 Rosetta Predictions human pricing
NM_001002001 Rosetta Predictions human pricing
NM_001002002 Rosetta Predictions human pricing
NM_016576 Rosetta Predictions human pricing
NM_001013036 Rosetta Predictions rat pricing
NM_134075 Rosetta Predictions mouse pricing
NM_177992 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230351 predicted 773
2 SASI_Hs01_00230352 predicted 1415
3 SASI_Hs01_00230353 predicted 986
4 SASI_Hs01_00230354 predicted 1399
5 SASI_Hs01_00230355 predicted 1232
6 SASI_Hs01_00230356 predicted 1573
7 SASI_Hs01_00230357 predicted 1217
8 SASI_Hs01_00230358 predicted 838
9 SASI_Hs01_00230359 predicted 1074
10 SASI_Hs01_00230360 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069382 predicted 718
2 SASI_Hs01_00069383 predicted 1356
3 SASI_Hs01_00069384 predicted 932
4 SASI_Hs01_00069385 predicted 1336
5 SASI_Hs01_00069386 predicted 1166
6 SASI_Hs01_00069387 predicted 1513
7 SASI_Hs01_00069388 predicted 1153
8 SASI_Hs01_00069389 predicted 776
9 SASI_Hs01_00069390 predicted 1010
10 SASI_Hs01_00069391 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036086 predicted 453
2 SASI_Hs01_00036087 predicted 1082
3 SASI_Hs01_00036088 predicted 659
4 SASI_Hs01_00036089 predicted 1071
5 SASI_Hs01_00036090 predicted 908
6 SASI_Hs01_00036091 predicted 1242
7 SASI_Hs01_00036092 predicted 890
8 SASI_Hs01_00036093 predicted 510
9 SASI_Hs01_00036094 predicted 746
10 SASI_Hs01_00036095 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195343 predicted 694
2 SASI_Hs01_00195344 predicted 1324
3 SASI_Hs01_00195345 predicted 903
4 SASI_Hs01_00195346 predicted 1311
5 SASI_Hs01_00195347 predicted 1140
6 SASI_Hs01_00195348 predicted 1488
7 SASI_Hs01_00195349 predicted 1133
8 SASI_Hs01_00195350 predicted 758
9 SASI_Hs01_00195351 predicted 983
10 SASI_Hs01_00195352 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200619 predicted 975
2 SASI_Rn02_00200620 predicted 1003
3 SASI_Rn02_00200621 predicted 420
4 SASI_Rn02_00200622 predicted 609
5 SASI_Rn02_00200623 predicted 334
6 SASI_Rn02_00200624 predicted 856
7 SASI_Rn02_00200625 predicted 270
8 SASI_Rn02_00200626 predicted 710
9 SASI_Rn02_00200627 predicted 367
10 SASI_Rn02_00200628 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188829 predicted 865
2 SASI_Mm01_00188830 predicted 983
3 SASI_Mm01_00188831 predicted 1089
4 SASI_Mm01_00188832 predicted 1083
5 SASI_Mm01_00188833 predicted 1050
6 SASI_Mm01_00188834 predicted 1017
7 SASI_Mm01_00188835 predicted 888
8 SASI_Mm01_00188836 predicted 896
9 SASI_Mm01_00188837 predicted 892
10 SASI_Mm01_00188838 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348446 predicted 1186
2 SASI_Mm02_00348447 predicted 493
3 SASI_Mm01_00161054 predicted 1127
4 SASI_Mm02_00348448 predicted 215
5 SASI_Mm02_00348449 predicted 441
6 SASI_Mm02_00348450 predicted 687
7 SASI_Mm02_00348451 predicted 1301
8 SASI_Mm02_00348452 predicted 196
9 SASI_Mm02_00348453 predicted 675
10 SASI_Mm02_00348454 predicted 982
11 SASI_Mm01_00161052 predicted 907
12 SASI_Mm01_00161053 predicted 1027
13 SASI_Mm01_00161055 predicted 1127
14 SASI_Mm01_00161056 predicted 1093
15 SASI_Mm01_00161057 predicted 1056
16 SASI_Mm01_00161058 predicted 922
17 SASI_Mm01_00161059 predicted 943
18 SASI_Mm01_00161060 predicted 931
19 SASI_Mm01_00161061 predicted 971
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134075
VALIDATED
GMPR2 MISSION shRNA Bacterial Glycerol Stock
guanosine monophosphate reductase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-509s1c1
Sequence:CCGGGCTAACGGCTACTCTGAACATCTCGAGATGTTCAGAGTAGCCGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-1079s1c1
Sequence:CCGGGCTGCTAAACTGAAGGAACTACTCGAGTAGTTCCTTCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-395s1c1
Sequence:CCGGCCTGACTGTCTTGAGTGTCTACTCGAGTAGACACTCAAGACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-1129s1c1
Sequence:CCGGCCAGCAAGTGAATCCAATCTTCTCGAGAAGATTGGATTCACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-916s1c1
Sequence:CCGGCTACGGAATGAGTTCTGAAATCTCGAGATTTCAGAACTCATTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134075
VALIDATED
GMPR2 MISSION shRNA shRNA Plasmid DNA
guanosine monophosphate reductase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-509s1c1
Sequence:CCGGGCTAACGGCTACTCTGAACATCTCGAGATGTTCAGAGTAGCCGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-1079s1c1
Sequence:CCGGGCTGCTAAACTGAAGGAACTACTCGAGTAGTTCCTTCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-395s1c1
Sequence:CCGGCCTGACTGTCTTGAGTGTCTACTCGAGTAGACACTCAAGACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-1129s1c1
Sequence:CCGGCCAGCAAGTGAATCCAATCTTCTCGAGAAGATTGGATTCACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-916s1c1
Sequence:CCGGCTACGGAATGAGTTCTGAAATCTCGAGATTTCAGAACTCATTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134075
VALIDATED
GMPR2 MISSION shRNA Lentiviral Transduction Particles
guanosine monophosphate reductase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-509s1c1
Sequence:CCGGGCTAACGGCTACTCTGAACATCTCGAGATGTTCAGAGTAGCCGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-1079s1c1
Sequence:CCGGGCTGCTAAACTGAAGGAACTACTCGAGTAGTTCCTTCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-395s1c1
Sequence:CCGGCCTGACTGTCTTGAGTGTCTACTCGAGTAGACACTCAAGACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-1129s1c1
Sequence:CCGGCCAGCAAGTGAATCCAATCTTCTCGAGAAGATTGGATTCACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134075.1-916s1c1
Sequence:CCGGCTACGGAATGAGTTCTGAAATCTCGAGATTTCAGAACTCATTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016576
VALIDATED
GMPR2 MISSION shRNA Bacterial Glycerol Stock
guanosine monophosphate reductase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016576.2-551s1c1
Sequence:CCGGCTGCTGTCCATAAGCACTATACTCGAGTATAGTGCTTATGGACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016576.2-1128s1c1
Sequence:CCGGCTATGGAATGAGTTCTGAAATCTCGAGATTTCAGAACTCATTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016576.2-472s1c1
Sequence:CCGGGTTCCCATCATTGCTGCCAATCTCGAGATTGGCAGCAATGATGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016576.2-974s1c1
Sequence:CCGGACATCATTTCAGATGGAGGTTCTCGAGAACCTCCATCTGAAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016576.2-1311s1c1
Sequence:CCGGGAGCAGGAGAACTACCTTCATCTCGAGATGAAGGTAGTTCTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016576.3-1667s21c1
Sequence:CCGGCAACATCCTGAAGATTATTAACTCGAGTTAATAATCTTCAGGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016576.3-1155s21c1
Sequence:CCGGCTATGGAATGAGTTCTGAAATCTCGAGATTTCAGAACTCATTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_016576.3-578s21c1
Sequence:CCGGCTGCTGTCCATAAGCACTATACTCGAGTATAGTGCTTATGGACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016576.3-350s21c1
Sequence:CCGGTAAGCGCCATGCCTCATATTGCTCGAGCAATATGAGGCATGGCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016576.3-1338s21c1
Sequence:CCGGGAGCAGGAGAACTACCTTCATCTCGAGATGAAGGTAGTTCTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016576
VALIDATED
GMPR2 MISSION shRNA shRNA Plasmid DNA
guanosine monophosphate reductase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016576.2-551s1c1
Sequence:CCGGCTGCTGTCCATAAGCACTATACTCGAGTATAGTGCTTATGGACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016576.2-1128s1c1
Sequence:CCGGCTATGGAATGAGTTCTGAAATCTCGAGATTTCAGAACTCATTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016576.2-472s1c1
Sequence:CCGGGTTCCCATCATTGCTGCCAATCTCGAGATTGGCAGCAATGATGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016576.2-974s1c1
Sequence:CCGGACATCATTTCAGATGGAGGTTCTCGAGAACCTCCATCTGAAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016576.2-1311s1c1
Sequence:CCGGGAGCAGGAGAACTACCTTCATCTCGAGATGAAGGTAGTTCTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016576.3-1667s21c1
Sequence:CCGGCAACATCCTGAAGATTATTAACTCGAGTTAATAATCTTCAGGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016576.3-1155s21c1
Sequence:CCGGCTATGGAATGAGTTCTGAAATCTCGAGATTTCAGAACTCATTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_016576.3-578s21c1
Sequence:CCGGCTGCTGTCCATAAGCACTATACTCGAGTATAGTGCTTATGGACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016576.3-350s21c1
Sequence:CCGGTAAGCGCCATGCCTCATATTGCTCGAGCAATATGAGGCATGGCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016576.3-1338s21c1
Sequence:CCGGGAGCAGGAGAACTACCTTCATCTCGAGATGAAGGTAGTTCTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016576
VALIDATED
GMPR2 MISSION shRNA Lentiviral Transduction Particles
guanosine monophosphate reductase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016576.2-551s1c1
Sequence:CCGGCTGCTGTCCATAAGCACTATACTCGAGTATAGTGCTTATGGACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016576.2-1128s1c1
Sequence:CCGGCTATGGAATGAGTTCTGAAATCTCGAGATTTCAGAACTCATTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016576.2-472s1c1
Sequence:CCGGGTTCCCATCATTGCTGCCAATCTCGAGATTGGCAGCAATGATGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016576.2-974s1c1
Sequence:CCGGACATCATTTCAGATGGAGGTTCTCGAGAACCTCCATCTGAAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016576.2-1311s1c1
Sequence:CCGGGAGCAGGAGAACTACCTTCATCTCGAGATGAAGGTAGTTCTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016576.3-1667s21c1
Sequence:CCGGCAACATCCTGAAGATTATTAACTCGAGTTAATAATCTTCAGGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016576.3-1155s21c1
Sequence:CCGGCTATGGAATGAGTTCTGAAATCTCGAGATTTCAGAACTCATTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_016576.3-578s21c1
Sequence:CCGGCTGCTGTCCATAAGCACTATACTCGAGTATAGTGCTTATGGACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016576.3-350s21c1
Sequence:CCGGTAAGCGCCATGCCTCATATTGCTCGAGCAATATGAGGCATGGCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016576.3-1338s21c1
Sequence:CCGGGAGCAGGAGAACTACCTTCATCTCGAGATGAAGGTAGTTCTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177992
GMPR2 MISSION shRNA Bacterial Glycerol Stock
guanosine monophosphate reductase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-550s21c3
Sequence:CCGGGCTAACGGCTACTCTGAACATCTCGAGATGTTCAGAGTAGCCGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-1120s21c2
Sequence:CCGGGCTGCTAAACTGAAGGAACTACTCGAGTAGTTCCTTCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-436s21c2
Sequence:CCGGCCTGACTGTCTTGAGTGTCTACTCGAGTAGACACTCAAGACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-957s21c2
Sequence:CCGGCTACGGAATGAGTTCTGAAATCTCGAGATTTCAGAACTCATTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-1170s21c1
Sequence:CCGGCCAGCAAGTGAATCCAATCTTCTCGAGAAGATTGGATTCACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177992
GMPR2 MISSION shRNA shRNA Plasmid DNA
guanosine monophosphate reductase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-550s21c3
Sequence:CCGGGCTAACGGCTACTCTGAACATCTCGAGATGTTCAGAGTAGCCGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-1120s21c2
Sequence:CCGGGCTGCTAAACTGAAGGAACTACTCGAGTAGTTCCTTCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-436s21c2
Sequence:CCGGCCTGACTGTCTTGAGTGTCTACTCGAGTAGACACTCAAGACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-957s21c2
Sequence:CCGGCTACGGAATGAGTTCTGAAATCTCGAGATTTCAGAACTCATTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-1170s21c1
Sequence:CCGGCCAGCAAGTGAATCCAATCTTCTCGAGAAGATTGGATTCACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177992
GMPR2 MISSION shRNA Lentiviral Transduction Particles
guanosine monophosphate reductase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-550s21c3
Sequence:CCGGGCTAACGGCTACTCTGAACATCTCGAGATGTTCAGAGTAGCCGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-1120s21c2
Sequence:CCGGGCTGCTAAACTGAAGGAACTACTCGAGTAGTTCCTTCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-436s21c2
Sequence:CCGGCCTGACTGTCTTGAGTGTCTACTCGAGTAGACACTCAAGACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-957s21c2
Sequence:CCGGCTACGGAATGAGTTCTGAAATCTCGAGATTTCAGAACTCATTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177992.2-1170s21c1
Sequence:CCGGCCAGCAAGTGAATCCAATCTTCTCGAGAAGATTGGATTCACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks