EMAIL THIS PAGE TO A FRIEND

GMPR

guanosine monophosphate reductase

54 Gene Product Result for
Synonyms: GMPR1
UniProtKB ID: P36959, Q96HQ6
Gene ID:
Human(2766) Summary: This gene encodes an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of GMP to IMP. The protein also functions in the re-utilization of free intracellular bases and purine nucleosides.[provided by RefSeq, Oct 2009]
Mouse(66355) guanosine monophosphate reductase
Rat(117533) guanosine monophosphate reductase
sheep(101102594) guanosine monophosphate reductase
domestic guinea pig(100719409) guanosine monophosphate reductase
naked mole-rat(101712019) guanosine monophosphate reductase
Zebrafish(553639) guanosine monophosphate reductase
dog(488231) guanosine monophosphate reductase
domestic cat(101092763) guanosine monophosphate reductase
cow(533000) guanosine monophosphate reductase
chicken(420842) guanosine monophosphate reductase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006877 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006877 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006877 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043121 MISSION® esiRNA esiRNA human GMPR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006877 Rosetta Predictions human pricing
NM_057188 Rosetta Predictions rat pricing
NM_025508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052759 predicted 713
2 SASI_Hs01_00052762 predicted 704
3 SASI_Hs01_00052763 predicted 363
4 SASI_Hs02_00342527 predicted 461
5 SASI_Hs01_00052764 predicted 599
6 SASI_Hs02_00342528 predicted 906
7 SASI_Hs01_00052765 predicted 326
8 SASI_Hs01_00052766 predicted 357
9 SASI_Hs01_00052767 predicted 974
10 SASI_Hs02_00342529 predicted 924
11 SASI_Hs01_00052758 predicted 535
12 SASI_Hs01_00052760 predicted 462
13 SASI_Hs01_00052761 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267139 predicted 1004
2 SASI_Rn01_00078769 predicted 499
3 SASI_Rn01_00078770 predicted 1188
4 SASI_Rn01_00078771 predicted 467
5 SASI_Rn01_00078772 predicted 989
6 SASI_Rn02_00267140 predicted 679
7 SASI_Rn01_00078773 predicted 350
8 SASI_Rn01_00078774 predicted 575
9 SASI_Rn01_00078775 predicted 450
10 SASI_Rn01_00078776 predicted 221
11 SASI_Rn01_00078777 predicted 544
12 SASI_Rn01_00078778 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195451 predicted 777
2 SASI_Mm01_00195453 predicted 1198
3 SASI_Mm01_00195454 predicted 1063
4 SASI_Mm02_00328395 predicted 1327
5 SASI_Mm01_00195455 predicted 613
6 SASI_Mm01_00195456 predicted 224
7 SASI_Mm01_00195457 predicted 519
8 SASI_Mm01_00195458 predicted 318
9 SASI_Mm01_00195459 predicted 458
10 SASI_Mm01_00195460 predicted 332
11 SASI_Mm01_00195452 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006877
GMPR MISSION shRNA Bacterial Glycerol Stock
guanosine monophosphate reductase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-326s1c1
Sequence:CCGGCCATGTTTACAGCAATTCATACTCGAGTATGAATTGCTGTAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-507s1c1
Sequence:CCGGCAATGGGTATTCAGAACATTTCTCGAGAAATGTTCTGAATACCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-988s1c1
Sequence:CCGGACTGTGGAAGTTCCTTACAAACTCGAGTTTGTAAGGAACTTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-601s1c1
Sequence:CCGGGAAATGGTAGAAGAGCTTATTCTCGAGAATAAGCTCTTCTACCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-218s1c1
Sequence:CCGGCCTTCACGTTTCGAAATTCAACTCGAGTTGAATTTCGAAACGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006877
GMPR MISSION shRNA shRNA Plasmid DNA
guanosine monophosphate reductase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-326s1c1
Sequence:CCGGCCATGTTTACAGCAATTCATACTCGAGTATGAATTGCTGTAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-507s1c1
Sequence:CCGGCAATGGGTATTCAGAACATTTCTCGAGAAATGTTCTGAATACCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-988s1c1
Sequence:CCGGACTGTGGAAGTTCCTTACAAACTCGAGTTTGTAAGGAACTTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-601s1c1
Sequence:CCGGGAAATGGTAGAAGAGCTTATTCTCGAGAATAAGCTCTTCTACCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-218s1c1
Sequence:CCGGCCTTCACGTTTCGAAATTCAACTCGAGTTGAATTTCGAAACGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006877
GMPR MISSION shRNA Lentiviral Transduction Particles
guanosine monophosphate reductase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-326s1c1
Sequence:CCGGCCATGTTTACAGCAATTCATACTCGAGTATGAATTGCTGTAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-507s1c1
Sequence:CCGGCAATGGGTATTCAGAACATTTCTCGAGAAATGTTCTGAATACCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-988s1c1
Sequence:CCGGACTGTGGAAGTTCCTTACAAACTCGAGTTTGTAAGGAACTTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-601s1c1
Sequence:CCGGGAAATGGTAGAAGAGCTTATTCTCGAGAATAAGCTCTTCTACCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006877.2-218s1c1
Sequence:CCGGCCTTCACGTTTCGAAATTCAACTCGAGTTGAATTTCGAAACGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025508
VALIDATED
GMPR MISSION shRNA Bacterial Glycerol Stock
guanosine monophosphate reductase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025508.1-1201s1c1
Sequence:CCGGCAACAGCACAACACGGTGTTTCTCGAGAAACACCGTGTTGTGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025508.1-1063s1c1
Sequence:CCGGACCGTGGAAGTGCCTTACAAACTCGAGTTTGTAAGGCACTTCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025508.1-397s1c1
Sequence:CCGGCATGCCATGTTTACAGCCGTTCTCGAGAACGGCTGTAAACATGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025508.1-507s1c1
Sequence:CCGGGCAGAATGATCTTGAGAGGATCTCGAGATCCTCTCAAGATCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025508.1-580s1c1
Sequence:CCGGGCCAATGGGTATTCAGAGCATCTCGAGATGCTCTGAATACCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025508
VALIDATED
GMPR MISSION shRNA shRNA Plasmid DNA
guanosine monophosphate reductase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025508.1-1201s1c1
Sequence:CCGGCAACAGCACAACACGGTGTTTCTCGAGAAACACCGTGTTGTGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025508.1-1063s1c1
Sequence:CCGGACCGTGGAAGTGCCTTACAAACTCGAGTTTGTAAGGCACTTCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025508.1-397s1c1
Sequence:CCGGCATGCCATGTTTACAGCCGTTCTCGAGAACGGCTGTAAACATGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025508.1-507s1c1
Sequence:CCGGGCAGAATGATCTTGAGAGGATCTCGAGATCCTCTCAAGATCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025508.1-580s1c1
Sequence:CCGGGCCAATGGGTATTCAGAGCATCTCGAGATGCTCTGAATACCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025508
VALIDATED
GMPR MISSION shRNA Lentiviral Transduction Particles
guanosine monophosphate reductase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025508.1-1201s1c1
Sequence:CCGGCAACAGCACAACACGGTGTTTCTCGAGAAACACCGTGTTGTGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025508.1-1063s1c1
Sequence:CCGGACCGTGGAAGTGCCTTACAAACTCGAGTTTGTAAGGCACTTCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025508.1-397s1c1
Sequence:CCGGCATGCCATGTTTACAGCCGTTCTCGAGAACGGCTGTAAACATGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025508.1-507s1c1
Sequence:CCGGGCAGAATGATCTTGAGAGGATCTCGAGATCCTCTCAAGATCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025508.1-580s1c1
Sequence:CCGGGCCAATGGGTATTCAGAGCATCTCGAGATGCTCTGAATACCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks