EMAIL THIS PAGE TO A FRIEND

GMPS

guanine monphosphate synthase

59 Gene Product Result for
UniProtKB ID: P49915
Gene ID:
Human(8833) Summary: In the de novo synthesis of purine nucleotides, IMP is the branch point metabolite at which point the pathway diverges to the synthesis of either guanine or adenine nucleotides. In the guanine nucleotide pathway, there are 2 enzymes involved in converting IMP to GMP, namely IMP dehydrogenase (IMPD1), which catalyzes the oxidation of IMP to XMP, and GMP synthetase, which catalyzes the amination of XMP to GMP. [provided by RefSeq, Jul 2008]
Mouse(229363) guanine monophosphate synthetase
Rat(295088) guanine monphosphate synthase
sheep(101111850) guanine monphosphate synthetase
Domestic Rabbit(100343988) guanine monphosphate synthetase
domestic guinea pig(100726973) guanine monphosphate synthase
naked mole-rat(101719752) guanine monphosphate synthetase
Zebrafish(393559) guanine monphosphate synthetase
cow(511200) guanine monphosphate synthetase
domestic cat(101088776) guanine monphosphate synthetase
dog(477123) guanine monphosphate synthetase
chicken(425028) guanine monphosphate synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033300 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033300 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033300 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003875 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003875 Rosetta Predictions human pricing
NM_001024754 Rosetta Predictions rat pricing
NM_001033300 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147352 predicted 2113
2 SASI_Hs01_00147353 predicted 1828
3 SASI_Hs02_00336466 predicted 500
4 SASI_Hs02_00336467 predicted 429
5 SASI_Hs01_00147355 predicted 2051
6 SASI_Hs02_00336468 predicted 359
7 SASI_Hs01_00147357 predicted 596
8 SASI_Hs01_00147358 predicted 1136
9 SASI_Hs01_00147359 predicted 989
10 SASI_Hs01_00147360 predicted 530
11 SASI_Hs01_00147354 predicted 2003
12 SASI_Hs01_00147356 predicted 1373
13 SASI_Hs01_00147361 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079638 predicted 843
2 SASI_Rn01_00079639 predicted 1840
3 SASI_Rn02_00202630 predicted 374
4 SASI_Rn01_00079640 predicted 323
5 SASI_Rn01_00079641 predicted 256
6 SASI_Rn01_00079642 predicted 458
7 SASI_Rn02_00202631 predicted 946
8 SASI_Rn01_00079643 predicted 1709
9 SASI_Rn01_00079644 predicted 865
10 SASI_Rn01_00079646 predicted 1544
11 SASI_Rn01_00079645 predicted 337
12 SASI_Rn01_00079647 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176319 predicted 2239
2 SASI_Mm01_00176320 predicted 643
3 SASI_Mm01_00176321 predicted 1822
4 SASI_Mm01_00176323 predicted 402
5 SASI_Mm02_00288501 predicted 1857
6 SASI_Mm01_00176325 predicted 330
7 SASI_Mm02_00288502 predicted 2261
8 SASI_Mm01_00176326 predicted 433
9 SASI_Mm01_00176327 predicted 2253
10 SASI_Mm01_00176328 predicted 1788
11 SASI_Mm01_00176322 predicted 1165
12 SASI_Mm01_00176324 predicted 1643
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033300
VALIDATED
GMPS MISSION shRNA Bacterial Glycerol Stock
guanine monphosphate synthase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033300.2-1485s21c1
Sequence:CCGGATGTGCTGAAGAACCTTATATCTCGAGATATAAGGTTCTTCAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033300.2-339s21c1
Sequence:CCGGACAAGGATTTCGGGCTATTATCTCGAGATAATAGCCCGAAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033300.2-2655s21c1
Sequence:CCGGATGCCATAGAAAGGTATAATACTCGAGTATTATACCTTTCTATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033300.2-174s21c1
Sequence:CCGGGAATGCTGGAGGAGATCTTAACTCGAGTTAAGATCTCCTCCAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033300
VALIDATED
GMPS MISSION shRNA shRNA Plasmid DNA
guanine monphosphate synthase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033300.2-1485s21c1
Sequence:CCGGATGTGCTGAAGAACCTTATATCTCGAGATATAAGGTTCTTCAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033300.2-339s21c1
Sequence:CCGGACAAGGATTTCGGGCTATTATCTCGAGATAATAGCCCGAAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033300.2-2655s21c1
Sequence:CCGGATGCCATAGAAAGGTATAATACTCGAGTATTATACCTTTCTATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033300.2-174s21c1
Sequence:CCGGGAATGCTGGAGGAGATCTTAACTCGAGTTAAGATCTCCTCCAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033300
VALIDATED
GMPS MISSION shRNA Lentiviral Transduction Particles
guanine monphosphate synthase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033300.2-1485s21c1
Sequence:CCGGATGTGCTGAAGAACCTTATATCTCGAGATATAAGGTTCTTCAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033300.2-339s21c1
Sequence:CCGGACAAGGATTTCGGGCTATTATCTCGAGATAATAGCCCGAAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033300.2-2655s21c1
Sequence:CCGGATGCCATAGAAAGGTATAATACTCGAGTATTATACCTTTCTATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033300.2-174s21c1
Sequence:CCGGGAATGCTGGAGGAGATCTTAACTCGAGTTAAGATCTCCTCCAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003875
GMPS MISSION shRNA Bacterial Glycerol Stock
guanine monphosphate synthase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-1988s21c1
Sequence:CCGGTCGCATGTGTCACAACGTTAACTCGAGTTAACGTTGTGACACATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-1252s21c1
Sequence:GTACCGGGAACAACAACCCTACCAATATCTCGAGATATTGGTAGGGTTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-1679s21c1
Sequence:CCGGATGTGCTGAAGAACCTTATATCTCGAGATATAAGGTTCTTCAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-603s21c1
Sequence:CCGGGATCCAGCAATATTCACTATTCTCGAGAATAGTGAATATTGCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-1437s21c1
Sequence:CCGGACTTTACGGCCTGATCTAATTCTCGAGAATTAGATCAGGCCGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-382s1c1
Sequence:CCGGCCTGGTTTGATCCAGCAATATCTCGAGATATTGCTGGATCAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-1447s1c1
Sequence:CCGGGCCTGGCAATCAGAGTAATATCTCGAGATATTACTCTGATTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-303s1c1
Sequence:CCGGGCATTTGCTATAAAGGAACAACTCGAGTTGTTCCTTTATAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-926s1c1
Sequence:CCGGGCACATTGATAATGGCTTTATCTCGAGATAAAGCCATTATCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-1696s1c1
Sequence:CCGGCCTACAGTTACGTGTGTGGAACTCGAGTTCCACACACGTAACTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003875
GMPS MISSION shRNA shRNA Plasmid DNA
guanine monphosphate synthase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-1988s21c1
Sequence:CCGGTCGCATGTGTCACAACGTTAACTCGAGTTAACGTTGTGACACATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-1252s21c1
Sequence:GTACCGGGAACAACAACCCTACCAATATCTCGAGATATTGGTAGGGTTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-1679s21c1
Sequence:CCGGATGTGCTGAAGAACCTTATATCTCGAGATATAAGGTTCTTCAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-603s21c1
Sequence:CCGGGATCCAGCAATATTCACTATTCTCGAGAATAGTGAATATTGCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-1437s21c1
Sequence:CCGGACTTTACGGCCTGATCTAATTCTCGAGAATTAGATCAGGCCGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-382s1c1
Sequence:CCGGCCTGGTTTGATCCAGCAATATCTCGAGATATTGCTGGATCAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-1447s1c1
Sequence:CCGGGCCTGGCAATCAGAGTAATATCTCGAGATATTACTCTGATTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-303s1c1
Sequence:CCGGGCATTTGCTATAAAGGAACAACTCGAGTTGTTCCTTTATAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-926s1c1
Sequence:CCGGGCACATTGATAATGGCTTTATCTCGAGATAAAGCCATTATCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-1696s1c1
Sequence:CCGGCCTACAGTTACGTGTGTGGAACTCGAGTTCCACACACGTAACTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003875
GMPS MISSION shRNA Lentiviral Transduction Particles
guanine monphosphate synthase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-1988s21c1
Sequence:CCGGTCGCATGTGTCACAACGTTAACTCGAGTTAACGTTGTGACACATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-1252s21c1
Sequence:GTACCGGGAACAACAACCCTACCAATATCTCGAGATATTGGTAGGGTTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-1679s21c1
Sequence:CCGGATGTGCTGAAGAACCTTATATCTCGAGATATAAGGTTCTTCAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-603s21c1
Sequence:CCGGGATCCAGCAATATTCACTATTCTCGAGAATAGTGAATATTGCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003875.2-1437s21c1
Sequence:CCGGACTTTACGGCCTGATCTAATTCTCGAGAATTAGATCAGGCCGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-382s1c1
Sequence:CCGGCCTGGTTTGATCCAGCAATATCTCGAGATATTGCTGGATCAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-1447s1c1
Sequence:CCGGGCCTGGCAATCAGAGTAATATCTCGAGATATTACTCTGATTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-303s1c1
Sequence:CCGGGCATTTGCTATAAAGGAACAACTCGAGTTGTTCCTTTATAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-926s1c1
Sequence:CCGGGCACATTGATAATGGCTTTATCTCGAGATAAAGCCATTATCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003875.1-1696s1c1
Sequence:CCGGCCTACAGTTACGTGTGTGGAACTCGAGTTCCACACACGTAACTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks