EMAIL THIS PAGE TO A FRIEND

GNA11

guanine nucleotide binding protein (G protein), alpha 11 (Gq class)

59 Gene Product Result for
Synonyms: GNA-11 HHC2 HYPOC2
UniProtKB ID: P29992, O15109, Q14350, Q6IB00
Gene ID:
Mouse(14672) guanine nucleotide binding protein, alpha 11
Rat(81662) guanine nucleotide binding protein, alpha 11
chicken(374077) guanine nucleotide binding protein (G protein), alpha 11 (Gq class)
cow(281788) guanine nucleotide binding protein (G protein), alpha 11 (Gq class)
domestic cat(101086541) guanine nucleotide binding protein (G protein), alpha 11 (Gq class)
dog(403914) guanine nucleotide binding protein (G protein), alpha 11 (Gq class)
domestic guinea pig(100715351) guanine nucleotide binding protein (G protein), alpha 11 (Gq class)
naked mole-rat(101722520) guanine nucleotide binding protein (G protein), alpha 11 (Gq class)
sheep(101119215) guanine nucleotide binding protein (G protein), alpha 11 (Gq class)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002067 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002067 Rosetta Predictions human pricing
NM_031033 Rosetta Predictions rat pricing
NM_010301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333137 predicted 1155
2 SASI_Hs02_00333138 predicted 459
3 SASI_Hs01_00187506 predicted 999
4 SASI_Hs01_00187509 predicted 457
5 SASI_Hs02_00333139 predicted 893
6 SASI_Hs01_00187510 predicted 962
7 SASI_Hs01_00187511 predicted 453
8 SASI_Hs02_00333140 predicted 901
9 SASI_Hs01_00187513 predicted 597
10 SASI_Hs01_00187514 predicted 442
11 SASI_Hs01_00187507 predicted 634
12 SASI_Hs01_00187508 predicted 747
13 SASI_Hs01_00187512 predicted 463
14 SASI_Hs01_00187515 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087805 predicted 217
2 SASI_Rn01_00087806 predicted 279
3 SASI_Rn01_00087807 predicted 385
4 SASI_Rn02_00264237 predicted 450
5 SASI_Rn01_00087808 predicted 456
6 SASI_Rn01_00087810 predicted 779
7 SASI_Rn01_00087811 predicted 426
8 SASI_Rn02_00264238 predicted 295
9 SASI_Rn01_00087813 predicted 328
10 SASI_Rn01_00087814 predicted 205
11 SASI_Rn01_00087809 predicted 673
12 SASI_Rn01_00087812 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110151 predicted 945
2 SASI_Mm01_00110152 predicted 968
3 SASI_Mm01_00110153 predicted 577
4 SASI_Mm01_00110154 predicted 569
5 SASI_Mm01_00110155 predicted 687
6 SASI_Mm01_00110156 predicted 529
7 SASI_Mm01_00110157 predicted 1124
8 SASI_Mm01_00110158 predicted 568
9 SASI_Mm01_00110159 predicted 764
10 SASI_Mm01_00110160 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002067
VALIDATED
GNA11 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha 11 (Gq class)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002067.1-1140s1c1
Sequence:CCGGCGACAGCGACAAGATCATCTACTCGAGTAGATGATCTTGTCGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002067.1-474s1c1
Sequence:CCGGGCTCAAGATCCTCTACAAGTACTCGAGTACTTGTAGAGGATCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002067.1-849s1c1
Sequence:CCGGGAACGTGACATCCATCATGTTCTCGAGAACATGATGGATGTCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002067.1-1236s1c1
Sequence:CCGGGCTCAACCTCAAGGAGTACAACTCGAGTTGTACTCCTTGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002067.1-768s1c1
Sequence:CCGGCGACCTGGAGAACATCATCTTCTCGAGAAGATGATGTTCTCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002067.2-530s21c1
Sequence:CCGGGCTCAAGATCCTCTACAAGTACTCGAGTACTTGTAGAGGATCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002067.2-824s21c1
Sequence:CCGGCGACCTGGAGAACATCATCTTCTCGAGAAGATGATGTTCTCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002067.2-1196s21c1
Sequence:CCGGCGACAGCGACAAGATCATCTACTCGAGTAGATGATCTTGTCGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002067.2-1292s21c1
Sequence:CCGGGCTCAACCTCAAGGAGTACAACTCGAGTTGTACTCCTTGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002067
VALIDATED
GNA11 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha 11 (Gq class)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002067.1-1140s1c1
Sequence:CCGGCGACAGCGACAAGATCATCTACTCGAGTAGATGATCTTGTCGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002067.1-474s1c1
Sequence:CCGGGCTCAAGATCCTCTACAAGTACTCGAGTACTTGTAGAGGATCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002067.1-849s1c1
Sequence:CCGGGAACGTGACATCCATCATGTTCTCGAGAACATGATGGATGTCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002067.1-1236s1c1
Sequence:CCGGGCTCAACCTCAAGGAGTACAACTCGAGTTGTACTCCTTGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002067.1-768s1c1
Sequence:CCGGCGACCTGGAGAACATCATCTTCTCGAGAAGATGATGTTCTCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002067.2-530s21c1
Sequence:CCGGGCTCAAGATCCTCTACAAGTACTCGAGTACTTGTAGAGGATCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002067.2-824s21c1
Sequence:CCGGCGACCTGGAGAACATCATCTTCTCGAGAAGATGATGTTCTCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002067.2-1196s21c1
Sequence:CCGGCGACAGCGACAAGATCATCTACTCGAGTAGATGATCTTGTCGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002067.2-1292s21c1
Sequence:CCGGGCTCAACCTCAAGGAGTACAACTCGAGTTGTACTCCTTGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002067
VALIDATED
GNA11 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha 11 (Gq class)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002067.1-1140s1c1
Sequence:CCGGCGACAGCGACAAGATCATCTACTCGAGTAGATGATCTTGTCGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002067.1-474s1c1
Sequence:CCGGGCTCAAGATCCTCTACAAGTACTCGAGTACTTGTAGAGGATCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002067.1-849s1c1
Sequence:CCGGGAACGTGACATCCATCATGTTCTCGAGAACATGATGGATGTCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002067.1-1236s1c1
Sequence:CCGGGCTCAACCTCAAGGAGTACAACTCGAGTTGTACTCCTTGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002067.1-768s1c1
Sequence:CCGGCGACCTGGAGAACATCATCTTCTCGAGAAGATGATGTTCTCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002067.2-530s21c1
Sequence:CCGGGCTCAAGATCCTCTACAAGTACTCGAGTACTTGTAGAGGATCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002067.2-824s21c1
Sequence:CCGGCGACCTGGAGAACATCATCTTCTCGAGAAGATGATGTTCTCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002067.2-1196s21c1
Sequence:CCGGCGACAGCGACAAGATCATCTACTCGAGTAGATGATCTTGTCGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002067.2-1292s21c1
Sequence:CCGGGCTCAACCTCAAGGAGTACAACTCGAGTTGTACTCCTTGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010301
VALIDATED
GNA11 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha 11 (Gq class)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010301.1-353s1c1
Sequence:CCGGCCTCTACAAGTATGAGCAGAACTCGAGTTCTGCTCATACTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010301.1-296s1c1
Sequence:CCGGCCAGAACATCTTTACCGCCATCTCGAGATGGCGGTAAAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010301.1-911s1c1
Sequence:CCGGCTCACACTTGGTCGATTACTTCTCGAGAAGTAATCGACCAAGTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010301.1-512s1c1
Sequence:CCGGGCTATCTGACTCGGCTAAGTACTCGAGTACTTAGCCGAGTCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010301.1-908s1c1
Sequence:CCGGGCACTCACACTTGGTCGATTACTCGAGTAATCGACCAAGTGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010301.3-1465s21c1
Sequence:CCGGCCACAGCCACAAGGCTATTAACTCGAGTTAATAGCCTTGTGGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010301.3-974s21c1
Sequence:CCGGCTCACACTTGGTCGATTACTTCTCGAGAAGTAATCGACCAAGTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010301.3-805s21c1
Sequence:CCGGTGGTGGCACTAAGCGAGTATGCTCGAGCATACTCGCTTAGTGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010301.3-352s21c1
Sequence:CCGGTGGTGTACCAGAACATCTTTACTCGAGTAAAGATGTTCTGGTACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010301.3-181s21c1
Sequence:CCGGTCAACGCGGAGATCGAGAAACCTCGAGGTTTCTCGATCTCCGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010301
VALIDATED
GNA11 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha 11 (Gq class)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010301.1-353s1c1
Sequence:CCGGCCTCTACAAGTATGAGCAGAACTCGAGTTCTGCTCATACTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010301.1-296s1c1
Sequence:CCGGCCAGAACATCTTTACCGCCATCTCGAGATGGCGGTAAAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010301.1-911s1c1
Sequence:CCGGCTCACACTTGGTCGATTACTTCTCGAGAAGTAATCGACCAAGTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010301.1-512s1c1
Sequence:CCGGGCTATCTGACTCGGCTAAGTACTCGAGTACTTAGCCGAGTCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010301.1-908s1c1
Sequence:CCGGGCACTCACACTTGGTCGATTACTCGAGTAATCGACCAAGTGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010301.3-1465s21c1
Sequence:CCGGCCACAGCCACAAGGCTATTAACTCGAGTTAATAGCCTTGTGGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010301.3-974s21c1
Sequence:CCGGCTCACACTTGGTCGATTACTTCTCGAGAAGTAATCGACCAAGTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010301.3-805s21c1
Sequence:CCGGTGGTGGCACTAAGCGAGTATGCTCGAGCATACTCGCTTAGTGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010301.3-352s21c1
Sequence:CCGGTGGTGTACCAGAACATCTTTACTCGAGTAAAGATGTTCTGGTACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010301.3-181s21c1
Sequence:CCGGTCAACGCGGAGATCGAGAAACCTCGAGGTTTCTCGATCTCCGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010301
VALIDATED
GNA11 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha 11 (Gq class)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010301.1-353s1c1
Sequence:CCGGCCTCTACAAGTATGAGCAGAACTCGAGTTCTGCTCATACTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010301.1-296s1c1
Sequence:CCGGCCAGAACATCTTTACCGCCATCTCGAGATGGCGGTAAAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010301.1-911s1c1
Sequence:CCGGCTCACACTTGGTCGATTACTTCTCGAGAAGTAATCGACCAAGTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010301.1-512s1c1
Sequence:CCGGGCTATCTGACTCGGCTAAGTACTCGAGTACTTAGCCGAGTCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010301.1-908s1c1
Sequence:CCGGGCACTCACACTTGGTCGATTACTCGAGTAATCGACCAAGTGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010301.3-1465s21c1
Sequence:CCGGCCACAGCCACAAGGCTATTAACTCGAGTTAATAGCCTTGTGGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010301.3-974s21c1
Sequence:CCGGCTCACACTTGGTCGATTACTTCTCGAGAAGTAATCGACCAAGTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010301.3-805s21c1
Sequence:CCGGTGGTGGCACTAAGCGAGTATGCTCGAGCATACTCGCTTAGTGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010301.3-352s21c1
Sequence:CCGGTGGTGTACCAGAACATCTTTACTCGAGTAAAGATGTTCTGGTACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010301.3-181s21c1
Sequence:CCGGTCAACGCGGAGATCGAGAAACCTCGAGGTTTCTCGATCTCCGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks