EMAIL THIS PAGE TO A FRIEND

GNA12

guanine nucleotide binding protein (G protein) alpha 12

61 Gene Product Result for
Synonyms: NNX3 RMP gep
UniProtKB ID: Q03113, A4D204, Q2T9L1, Q86UM8, Q8TD71, Q9UDU9
Gene ID:
Mouse(14673) guanine nucleotide binding protein, alpha 12
Rat(81663) guanine nucleotide binding protein (G protein) alpha 12
chicken(769924) guanine nucleotide binding protein (G protein) alpha 12
dog(609567) guanine nucleotide binding protein (G protein) alpha 12
cow(515159) guanine nucleotide binding protein (G protein) alpha 12
domestic cat(101093316) guanine nucleotide binding protein (G protein) alpha 12
sheep(101111070) guanine nucleotide binding protein (G protein) alpha 12
domestic guinea pig(100726202) guanine nucleotide binding protein (G protein) alpha 12
naked mole-rat(101697421) guanine nucleotide binding protein (G protein) alpha 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010302 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010302 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010302 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007353 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059811 MISSION® esiRNA esiRNA human GNA12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007353 Rosetta Predictions human pricing
NM_031034 Rosetta Predictions rat pricing
NM_010302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150735 predicted 795
2 SASI_Hs01_00150737 predicted 899
3 SASI_Hs02_00343450 predicted 693
4 SASI_Hs01_00150738 predicted 479
5 SASI_Hs01_00150739 predicted 1360
6 SASI_Hs01_00150741 predicted 549
7 SASI_Hs01_00150742 predicted 655
8 SASI_Hs01_00150743 predicted 957
9 SASI_Hs02_00343451 predicted 1152
10 SASI_Hs01_00150744 predicted 468
11 SASI_Hs01_00150736 predicted 512
12 SASI_Hs01_00150740 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058745 predicted 585
2 SASI_Rn01_00058746 predicted 970
3 SASI_Rn01_00058747 predicted 781
4 SASI_Rn01_00058748 predicted 692
5 SASI_Rn01_00058749 predicted 654
6 SASI_Rn01_00058750 predicted 797
7 SASI_Rn01_00058751 predicted 688
8 SASI_Rn01_00058752 predicted 972
9 SASI_Rn01_00058753 predicted 1112
10 SASI_Rn01_00058754 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071118 predicted 754
2 SASI_Mm01_00071119 predicted 632
3 SASI_Mm01_00071120 predicted 672
4 SASI_Mm01_00071121 predicted 1449
5 SASI_Mm02_00318272 predicted 1378
6 SASI_Mm01_00071122 predicted 1372
7 SASI_Mm01_00071123 predicted 859
8 SASI_Mm01_00071124 predicted 650
9 SASI_Mm01_00071126 predicted 1035
10 SASI_Mm01_00071127 predicted 1509
11 SASI_Mm01_00071125 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010302
VALIDATED
GNA12 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein) alpha 12
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010302.2-1199s21c1
Sequence:CCGGAGAACATCCGCTTCGTGTTTCCTCGAGGAAACACGAAGCGGATGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010302.2-500s21c1
Sequence:CCGGACGAGAAGCACGGGATGTTTCCTCGAGGAAACATCCCGTGCTTCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010302.2-418s21c1
Sequence:CCGGATCTTCGACAACATCCTTAAGCTCGAGCTTAAGGATGTTGTCGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-1553s1c1
Sequence:CCGGCGCCTCTCTACAGAAACTCTTCTCGAGAAGAGTTTCTGTAGAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-762s1c1
Sequence:CCGGCGTGGAACATGACTTCGTTATCTCGAGATAACGAAGTCATGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-676s1c1
Sequence:CCGGCTGGATAACTTGGACCGGATTCTCGAGAATCCGGTCCAAGTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-960s1c1
Sequence:CCGGCGAGACCATCGTCAACAACAACTCGAGTTGTTGTTGACGATGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-651s1c1
Sequence:CCGGGCTGGGTGAATCAGTGAAGTACTCGAGTACTTCACTGATTCACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010302
VALIDATED
GNA12 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein) alpha 12
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010302.2-1199s21c1
Sequence:CCGGAGAACATCCGCTTCGTGTTTCCTCGAGGAAACACGAAGCGGATGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010302.2-500s21c1
Sequence:CCGGACGAGAAGCACGGGATGTTTCCTCGAGGAAACATCCCGTGCTTCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010302.2-418s21c1
Sequence:CCGGATCTTCGACAACATCCTTAAGCTCGAGCTTAAGGATGTTGTCGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-1553s1c1
Sequence:CCGGCGCCTCTCTACAGAAACTCTTCTCGAGAAGAGTTTCTGTAGAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-762s1c1
Sequence:CCGGCGTGGAACATGACTTCGTTATCTCGAGATAACGAAGTCATGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-676s1c1
Sequence:CCGGCTGGATAACTTGGACCGGATTCTCGAGAATCCGGTCCAAGTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-960s1c1
Sequence:CCGGCGAGACCATCGTCAACAACAACTCGAGTTGTTGTTGACGATGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-651s1c1
Sequence:CCGGGCTGGGTGAATCAGTGAAGTACTCGAGTACTTCACTGATTCACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010302
VALIDATED
GNA12 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein) alpha 12
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010302.2-1199s21c1
Sequence:CCGGAGAACATCCGCTTCGTGTTTCCTCGAGGAAACACGAAGCGGATGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010302.2-500s21c1
Sequence:CCGGACGAGAAGCACGGGATGTTTCCTCGAGGAAACATCCCGTGCTTCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010302.2-418s21c1
Sequence:CCGGATCTTCGACAACATCCTTAAGCTCGAGCTTAAGGATGTTGTCGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-1553s1c1
Sequence:CCGGCGCCTCTCTACAGAAACTCTTCTCGAGAAGAGTTTCTGTAGAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-762s1c1
Sequence:CCGGCGTGGAACATGACTTCGTTATCTCGAGATAACGAAGTCATGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-676s1c1
Sequence:CCGGCTGGATAACTTGGACCGGATTCTCGAGAATCCGGTCCAAGTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-960s1c1
Sequence:CCGGCGAGACCATCGTCAACAACAACTCGAGTTGTTGTTGACGATGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010302.1-651s1c1
Sequence:CCGGGCTGGGTGAATCAGTGAAGTACTCGAGTACTTCACTGATTCACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007353
GNA12 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein) alpha 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007353.2-1542s1c1
Sequence:CCGGCGAGTGATGATGTTGTGAATACTCGAGTATTCACAACATCATCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007353.2-737s1c1
Sequence:CCGGGCTGAATTACTTTCCTAGTAACTCGAGTTACTAGGAAAGTAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007353.2-495s1c1
Sequence:CCGGGCACGAGATAAGCTTGGCATTCTCGAGAATGCCAAGCTTATCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007353.2-1004s1c1
Sequence:CCGGCGTCAACAACAAGCTCTTCTTCTCGAGAAGAAGAGCTTGTTGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007353.2-1253s1c1
Sequence:CCGGCCATGCTGTGAAAGACACCATCTCGAGATGGTGTCTTTCACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007353
GNA12 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein) alpha 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007353.2-1542s1c1
Sequence:CCGGCGAGTGATGATGTTGTGAATACTCGAGTATTCACAACATCATCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007353.2-737s1c1
Sequence:CCGGGCTGAATTACTTTCCTAGTAACTCGAGTTACTAGGAAAGTAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007353.2-495s1c1
Sequence:CCGGGCACGAGATAAGCTTGGCATTCTCGAGAATGCCAAGCTTATCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007353.2-1004s1c1
Sequence:CCGGCGTCAACAACAAGCTCTTCTTCTCGAGAAGAAGAGCTTGTTGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007353.2-1253s1c1
Sequence:CCGGCCATGCTGTGAAAGACACCATCTCGAGATGGTGTCTTTCACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007353
GNA12 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein) alpha 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007353.2-1542s1c1
Sequence:CCGGCGAGTGATGATGTTGTGAATACTCGAGTATTCACAACATCATCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007353.2-737s1c1
Sequence:CCGGGCTGAATTACTTTCCTAGTAACTCGAGTTACTAGGAAAGTAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007353.2-495s1c1
Sequence:CCGGGCACGAGATAAGCTTGGCATTCTCGAGAATGCCAAGCTTATCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007353.2-1004s1c1
Sequence:CCGGCGTCAACAACAAGCTCTTCTTCTCGAGAAGAAGAGCTTGTTGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007353.2-1253s1c1
Sequence:CCGGCCATGCTGTGAAAGACACCATCTCGAGATGGTGTCTTTCACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks