EMAIL THIS PAGE TO A FRIEND

GNA13

guanine nucleotide binding protein (G protein), alpha 13

Synonyms: G13
UniProtKB ID: Q14344, B2R977, Q8TD70
Gene ID:
Mouse(14674) guanine nucleotide binding protein, alpha 13
Rat(303634) guanine nucleotide binding protein (G protein), alpha 13
chicken(417434) guanine nucleotide binding protein (G protein), alpha 13
dog(490901) guanine nucleotide binding protein (G protein), alpha 13
cow(505611) guanine nucleotide binding protein (G protein), alpha 13
domestic cat(101087625) guanine nucleotide binding protein (G protein), alpha 13
domestic guinea pig(100730887) guanine nucleotide binding protein (G protein), alpha 13
naked mole-rat(101719378) guanine nucleotide binding protein (G protein), alpha 13
sheep(101117003) guanine nucleotide binding protein (G protein), alpha 13
Domestic Rabbit(100352794) guanine nucleotide binding protein (G protein), alpha 13
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006572 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006572 Rosetta Predictions human pricing
NM_001013119 Rosetta Predictions rat pricing
NM_010303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193587 predicted 533
2 SASI_Hs01_00193588 predicted 892
3 SASI_Hs01_00193589 predicted 942
4 SASI_Hs02_00341857 predicted 928
5 SASI_Hs01_00193591 predicted 333
6 SASI_Hs01_00193592 predicted 904
7 SASI_Hs01_00193593 predicted 607
8 SASI_Hs01_00193594 predicted 650
9 SASI_Hs01_00193595 predicted 837
10 SASI_Hs01_00193596 predicted 747
11 SASI_Hs01_00193590 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032792 predicted 839
2 SASI_Rn02_00200825 predicted 700
3 SASI_Rn02_00200826 predicted 421
4 SASI_Rn01_00032794 predicted 279
5 SASI_Rn01_00032795 predicted 252
6 SASI_Rn01_00032797 predicted 614
7 SASI_Rn01_00032798 predicted 524
8 SASI_Rn01_00032799 predicted 693
9 SASI_Rn01_00032800 predicted 887
10 SASI_Rn02_00200827 predicted 508
11 SASI_Rn01_00032791 predicted 917
12 SASI_Rn01_00032793 predicted 429
13 SASI_Rn01_00032796 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035476 predicted 1128
2 SASI_Mm01_00035477 predicted 625
3 SASI_Mm01_00035478 predicted 1082
4 SASI_Mm01_00035479 predicted 910
5 SASI_Mm02_00318273 predicted 1409
6 SASI_Mm01_00035480 predicted 1086
7 SASI_Mm01_00035481 predicted 638
8 SASI_Mm01_00035482 predicted 606
9 SASI_Mm01_00035483 predicted 462
10 SASI_Mm01_00035484 predicted 877
11 SASI_Mm01_00035485 predicted 1088
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006572
GNA13 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha 13
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-1131s1c1
Sequence:CCGGCCGTGACGTGAAGGATACTATCTCGAGATAGTATCCTTCACGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-875s1c1
Sequence:CCGGCAATCGTCAATAACCGGGTTTCTCGAGAAACCCGGTTATTGACGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-412s1c1
Sequence:CCGGGATAAGATGATGTCGTTTGATCTCGAGATCAAACGACATCATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-358s1c1
Sequence:CCGGGCTCGAGAGAAGCTTCATATTCTCGAGAATATGAAGCTTCTCTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-904s1c1
Sequence:CCGGGTCTCCATAATTCTGTTCTTACTCGAGTAAGAACAGAATTATGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006572.4-472s21c1
Sequence:CCGGTCTACAGCAACGTGATCAAAGCTCGAGCTTTGATCACGTTGCTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006572.4-1771s21c1
Sequence:CCGGGACACTTGTTGCCTAACTTTACTCGAGTAAAGTTAGGCAACAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006572
GNA13 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha 13
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-1131s1c1
Sequence:CCGGCCGTGACGTGAAGGATACTATCTCGAGATAGTATCCTTCACGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-875s1c1
Sequence:CCGGCAATCGTCAATAACCGGGTTTCTCGAGAAACCCGGTTATTGACGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-412s1c1
Sequence:CCGGGATAAGATGATGTCGTTTGATCTCGAGATCAAACGACATCATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-358s1c1
Sequence:CCGGGCTCGAGAGAAGCTTCATATTCTCGAGAATATGAAGCTTCTCTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-904s1c1
Sequence:CCGGGTCTCCATAATTCTGTTCTTACTCGAGTAAGAACAGAATTATGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006572.4-472s21c1
Sequence:CCGGTCTACAGCAACGTGATCAAAGCTCGAGCTTTGATCACGTTGCTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006572.4-1771s21c1
Sequence:CCGGGACACTTGTTGCCTAACTTTACTCGAGTAAAGTTAGGCAACAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006572
GNA13 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha 13
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-1131s1c1
Sequence:CCGGCCGTGACGTGAAGGATACTATCTCGAGATAGTATCCTTCACGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-875s1c1
Sequence:CCGGCAATCGTCAATAACCGGGTTTCTCGAGAAACCCGGTTATTGACGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-412s1c1
Sequence:CCGGGATAAGATGATGTCGTTTGATCTCGAGATCAAACGACATCATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-358s1c1
Sequence:CCGGGCTCGAGAGAAGCTTCATATTCTCGAGAATATGAAGCTTCTCTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006572.3-904s1c1
Sequence:CCGGGTCTCCATAATTCTGTTCTTACTCGAGTAAGAACAGAATTATGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006572.4-472s21c1
Sequence:CCGGTCTACAGCAACGTGATCAAAGCTCGAGCTTTGATCACGTTGCTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006572.4-1771s21c1
Sequence:CCGGGACACTTGTTGCCTAACTTTACTCGAGTAAAGTTAGGCAACAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010303
VALIDATED
GNA13 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010303.2-1431s1c1
Sequence:CCGGGCAACCTTACACTAGGTGTTTCTCGAGAAACACCTAGTGTAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010303.2-1078s1c1
Sequence:CCGGCGCGATCAACACAGAGAACATCTCGAGATGTTCTCTGTGTTGATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010303.2-769s1c1
Sequence:CCGGCCTTGTCTCTTCAAGTGAATTCTCGAGAATTCACTTGAAGAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010303.2-541s1c1
Sequence:CCGGGCTGGGTGAGTCTGTAAAGTACTCGAGTACTTTACAGACTCACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010303.2-826s1c1
Sequence:CCGGCCTTACAGAATCTCTGAACATCTCGAGATGTTCAGAGATTCTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010303
VALIDATED
GNA13 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010303.2-1431s1c1
Sequence:CCGGGCAACCTTACACTAGGTGTTTCTCGAGAAACACCTAGTGTAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010303.2-1078s1c1
Sequence:CCGGCGCGATCAACACAGAGAACATCTCGAGATGTTCTCTGTGTTGATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010303.2-769s1c1
Sequence:CCGGCCTTGTCTCTTCAAGTGAATTCTCGAGAATTCACTTGAAGAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010303.2-541s1c1
Sequence:CCGGGCTGGGTGAGTCTGTAAAGTACTCGAGTACTTTACAGACTCACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010303.2-826s1c1
Sequence:CCGGCCTTACAGAATCTCTGAACATCTCGAGATGTTCAGAGATTCTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010303
VALIDATED
GNA13 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010303.2-1431s1c1
Sequence:CCGGGCAACCTTACACTAGGTGTTTCTCGAGAAACACCTAGTGTAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010303.2-1078s1c1
Sequence:CCGGCGCGATCAACACAGAGAACATCTCGAGATGTTCTCTGTGTTGATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010303.2-769s1c1
Sequence:CCGGCCTTGTCTCTTCAAGTGAATTCTCGAGAATTCACTTGAAGAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010303.2-541s1c1
Sequence:CCGGGCTGGGTGAGTCTGTAAAGTACTCGAGTACTTTACAGACTCACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010303.2-826s1c1
Sequence:CCGGCCTTACAGAATCTCTGAACATCTCGAGATGTTCAGAGATTCTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks