EMAIL THIS PAGE TO A FRIEND

GNA14

guanine nucleotide binding protein (G protein), alpha 14

44 Gene Product Result for
UniProtKB ID: O95837
Gene ID:
Human(9630) Summary: This gene encodes a member of the guanine nucleotide-binding, or G protein family. G proteins are heterotrimers consisting of alpha, beta and gamma subunits. The encoded protein is a member of the alpha family of G proteins, more specifically the alpha q subfamily of G proteins. The encoded protein may play a role in pertussis-toxin resistant activation of phospholipase C-beta and its downstream effectors.[provided by RefSeq, Feb 2009]
Mouse(14675) guanine nucleotide binding protein, alpha 14
Rat(309242) guanine nucleotide binding protein, alpha 14
Zebrafish(445297) guanine nucleotide binding protein (G protein), alpha 14
domestic cat(101094457) guanine nucleotide binding protein (G protein), alpha 14
cow(281789) guanine nucleotide binding protein (G protein), alpha 14
dog(484156) guanine nucleotide binding protein (G protein), alpha 14
chicken(431611) guanine nucleotide binding protein (G protein), alpha 14
sheep(101121067) guanine nucleotide binding protein (G protein), alpha 14
Domestic Rabbit(100348365) guanine nucleotide binding protein (G protein), alpha 14
domestic guinea pig(100731029) guanine nucleotide binding protein (G protein), alpha 14
naked mole-rat(101713421) guanine nucleotide binding protein (G protein), alpha 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008137 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008137 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008137 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004297 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004297 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004297 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004297 Rosetta Predictions human pricing
NM_001013151 Rosetta Predictions rat pricing
NM_008137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214579 predicted 807
2 SASI_Hs01_00214580 predicted 884
3 SASI_Hs01_00214581 predicted 1534
4 SASI_Hs01_00214582 predicted 1447
5 SASI_Hs01_00214583 predicted 1353
6 SASI_Hs01_00214584 predicted 965
7 SASI_Hs01_00214585 predicted 1244
8 SASI_Hs01_00214586 predicted 1545
9 SASI_Hs01_00214587 predicted 1529
10 SASI_Hs02_00337311 predicted 1285
11 SASI_Hs01_00214578 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030687 predicted 980
2 SASI_Rn01_00030688 predicted 1152
3 SASI_Rn02_00200879 predicted 1383
4 SASI_Rn01_00030689 predicted 1530
5 SASI_Rn01_00030691 predicted 1419
6 SASI_Rn01_00030692 predicted 955
7 SASI_Rn01_00030693 predicted 1190
8 SASI_Rn01_00030694 predicted 1219
9 SASI_Rn01_00030695 predicted 966
10 SASI_Rn01_00030696 predicted 1332
11 SASI_Rn01_00030690 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037674 predicted 1475
2 SASI_Mm01_00037675 predicted 1962
3 SASI_Mm01_00037676 predicted 1979
4 SASI_Mm01_00037677 predicted 1695
5 SASI_Mm01_00037678 predicted 1707
6 SASI_Mm01_00037679 predicted 1858
7 SASI_Mm01_00037680 predicted 2166
8 SASI_Mm01_00037681 predicted 2070
9 SASI_Mm01_00037682 predicted 1655
10 SASI_Mm01_00037683 predicted 2038
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008137
GNA14 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008137.2-2909s1c1
Sequence:CCGGCCGAGCTATATCCCAAACCAACTCGAGTTGGTTTGGGATATAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008137.2-1725s1c1
Sequence:CCGGCGTGATTCTGTTCTTAAACAACTCGAGTTGTTTAAGAACAGAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008137.2-1377s1c1
Sequence:CCGGGCTGTCAGACTCTGCCAAATACTCGAGTATTTGGCAGAGTCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008137.2-1948s1c1
Sequence:CCGGGCTGTCAAAGACACAATCCTACTCGAGTAGGATTGTGTCTTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008137.2-1198s1c1
Sequence:CCGGGCAATGGATACCCTGAGGATACTCGAGTATCCTCAGGGTATCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008137
GNA14 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008137.2-2909s1c1
Sequence:CCGGCCGAGCTATATCCCAAACCAACTCGAGTTGGTTTGGGATATAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008137.2-1725s1c1
Sequence:CCGGCGTGATTCTGTTCTTAAACAACTCGAGTTGTTTAAGAACAGAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008137.2-1377s1c1
Sequence:CCGGGCTGTCAGACTCTGCCAAATACTCGAGTATTTGGCAGAGTCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008137.2-1948s1c1
Sequence:CCGGGCTGTCAAAGACACAATCCTACTCGAGTAGGATTGTGTCTTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008137.2-1198s1c1
Sequence:CCGGGCAATGGATACCCTGAGGATACTCGAGTATCCTCAGGGTATCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008137
GNA14 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008137.2-2909s1c1
Sequence:CCGGCCGAGCTATATCCCAAACCAACTCGAGTTGGTTTGGGATATAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008137.2-1725s1c1
Sequence:CCGGCGTGATTCTGTTCTTAAACAACTCGAGTTGTTTAAGAACAGAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008137.2-1377s1c1
Sequence:CCGGGCTGTCAGACTCTGCCAAATACTCGAGTATTTGGCAGAGTCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008137.2-1948s1c1
Sequence:CCGGGCTGTCAAAGACACAATCCTACTCGAGTAGGATTGTGTCTTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008137.2-1198s1c1
Sequence:CCGGGCAATGGATACCCTGAGGATACTCGAGTATCCTCAGGGTATCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004297
GNA14 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha 14
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-1379s1c1
Sequence:CCGGCCAGAATACACAGGACCGAAACTCGAGTTTCGGTCCTGTGTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-1526s1c1
Sequence:CCGGGCTGCTGTCAAAGACACAATTCTCGAGAATTGTGTCTTTGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-1247s1c1
Sequence:CCGGGAAGAGAGCAAAGCCTTATTTCTCGAGAAATAAGGCTTTGCTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-1492s1c1
Sequence:CCGGTGCTACAGATACAGACAATATCTCGAGATATTGTCTGTATCTGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-806s1c1
Sequence:CCGGGTGTGTGAACAGAATAAGGAACTCGAGTTCCTTATTCTGTTCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004297
GNA14 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha 14
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-1379s1c1
Sequence:CCGGCCAGAATACACAGGACCGAAACTCGAGTTTCGGTCCTGTGTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-1526s1c1
Sequence:CCGGGCTGCTGTCAAAGACACAATTCTCGAGAATTGTGTCTTTGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-1247s1c1
Sequence:CCGGGAAGAGAGCAAAGCCTTATTTCTCGAGAAATAAGGCTTTGCTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-1492s1c1
Sequence:CCGGTGCTACAGATACAGACAATATCTCGAGATATTGTCTGTATCTGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-806s1c1
Sequence:CCGGGTGTGTGAACAGAATAAGGAACTCGAGTTCCTTATTCTGTTCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004297
GNA14 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha 14
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-1379s1c1
Sequence:CCGGCCAGAATACACAGGACCGAAACTCGAGTTTCGGTCCTGTGTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-1526s1c1
Sequence:CCGGGCTGCTGTCAAAGACACAATTCTCGAGAATTGTGTCTTTGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-1247s1c1
Sequence:CCGGGAAGAGAGCAAAGCCTTATTTCTCGAGAAATAAGGCTTTGCTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-1492s1c1
Sequence:CCGGTGCTACAGATACAGACAATATCTCGAGATATTGTCTGTATCTGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004297.2-806s1c1
Sequence:CCGGGTGTGTGAACAGAATAAGGAACTCGAGTTCCTTATTCTGTTCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks