EMAIL THIS PAGE TO A FRIEND

GNA15

guanine nucleotide binding protein (G protein), alpha 15 (Gq class)

Synonyms: GNA16
UniProtKB ID: P30679, E9KL40, E9KL47, O75247, Q53XK2
Gene ID:
Mouse(14676) guanine nucleotide binding protein, alpha 15
Rat(89788) guanine nucleotide binding protein, alpha 15
dog(485063) guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
cow(532029) guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
domestic cat(101086789) guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
domestic guinea pig(100714518) guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
naked mole-rat(101721934) guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
sheep(101118952) guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
Domestic Rabbit(100009469) guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002068 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010304 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010304 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010304 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057071 MISSION® esiRNA esiRNA human GNA15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002068 Rosetta Predictions human pricing
NM_053542 Rosetta Predictions rat pricing
NM_010304 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333141 predicted 1033
2 SASI_Hs01_00217596 predicted 884
3 SASI_Hs01_00217597 predicted 1303
4 SASI_Hs01_00217598 predicted 880
5 SASI_Hs01_00217599 predicted 1298
6 SASI_Hs02_00333142 predicted 1268
7 SASI_Hs01_00217601 predicted 343
8 SASI_Hs01_00217604 predicted 1670
9 SASI_Hs01_00217602 predicted 696
10 SASI_Hs02_00333143 predicted 1264
11 SASI_Hs01_00217600 predicted 1224
12 SASI_Hs01_00217603 predicted 1406
13 SASI_Hs01_00217605 predicted 1561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071779 predicted 198
2 SASI_Rn01_00071780 predicted 1409
3 SASI_Rn01_00071781 predicted 786
4 SASI_Rn02_00266163 predicted 785
5 SASI_Rn01_00071783 predicted 631
6 SASI_Rn01_00071784 predicted 1346
7 SASI_Rn01_00071785 predicted 543
8 SASI_Rn01_00071786 predicted 1420
9 SASI_Rn01_00071787 predicted 717
10 SASI_Rn01_00071788 predicted 586
11 SASI_Rn01_00071782 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173352 predicted 1683
2 SASI_Mm01_00173353 predicted 313
3 SASI_Mm01_00173354 predicted 978
4 SASI_Mm01_00173355 predicted 1023
5 SASI_Mm01_00173356 predicted 526
6 SASI_Mm01_00173357 predicted 496
7 SASI_Mm01_00173358 predicted 1590
8 SASI_Mm01_00173359 predicted 839
9 SASI_Mm01_00173360 predicted 986
10 SASI_Mm02_00318274 predicted 924
11 SASI_Mm01_00173361 predicted 922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002068
GNA15 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-580s1c1
Sequence:CCGGCCCTATAAAGTGACCACGTTTCTCGAGAAACGTGGTCACTTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-981s1c1
Sequence:CCGGCCTCGCATTGTTTGGGACTATCTCGAGATAGTCCCAAACAATGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-684s1c1
Sequence:CCGGCCTGCTCGATTCAGCCGTGTACTCGAGTACACGGCTGAATCGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-1143s1c1
Sequence:CCGGCAAGAGGTTCATCCTGGACATCTCGAGATGTCCAGGATGAACCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-879s1c1
Sequence:CCGGCCATTGTTTCGAGAACGTGATCTCGAGATCACGTTCTCGAAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002068.2-1064s21c1
Sequence:CCGGGCACATCCGTCATCCTCTTTCCTCGAGGAAAGAGGATGACGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002068.2-992s21c1
Sequence:CCGGACAACCAGGAGAACCGCATGACTCGAGTCATGCGGTTCTCCTGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002068
GNA15 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-580s1c1
Sequence:CCGGCCCTATAAAGTGACCACGTTTCTCGAGAAACGTGGTCACTTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-981s1c1
Sequence:CCGGCCTCGCATTGTTTGGGACTATCTCGAGATAGTCCCAAACAATGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-684s1c1
Sequence:CCGGCCTGCTCGATTCAGCCGTGTACTCGAGTACACGGCTGAATCGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-1143s1c1
Sequence:CCGGCAAGAGGTTCATCCTGGACATCTCGAGATGTCCAGGATGAACCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-879s1c1
Sequence:CCGGCCATTGTTTCGAGAACGTGATCTCGAGATCACGTTCTCGAAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002068.2-1064s21c1
Sequence:CCGGGCACATCCGTCATCCTCTTTCCTCGAGGAAAGAGGATGACGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002068.2-992s21c1
Sequence:CCGGACAACCAGGAGAACCGCATGACTCGAGTCATGCGGTTCTCCTGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002068
GNA15 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-580s1c1
Sequence:CCGGCCCTATAAAGTGACCACGTTTCTCGAGAAACGTGGTCACTTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-981s1c1
Sequence:CCGGCCTCGCATTGTTTGGGACTATCTCGAGATAGTCCCAAACAATGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-684s1c1
Sequence:CCGGCCTGCTCGATTCAGCCGTGTACTCGAGTACACGGCTGAATCGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-1143s1c1
Sequence:CCGGCAAGAGGTTCATCCTGGACATCTCGAGATGTCCAGGATGAACCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002068.1-879s1c1
Sequence:CCGGCCATTGTTTCGAGAACGTGATCTCGAGATCACGTTCTCGAAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002068.2-1064s21c1
Sequence:CCGGGCACATCCGTCATCCTCTTTCCTCGAGGAAAGAGGATGACGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002068.2-992s21c1
Sequence:CCGGACAACCAGGAGAACCGCATGACTCGAGTCATGCGGTTCTCCTGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010304
GNA15 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010304.3-932s1c1
Sequence:CCGGCACTGTTTCGAGAACGTGATTCTCGAGAATCACGTTCTCGAAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010304.3-931s1c1
Sequence:CCGGTCACTGTTTCGAGAACGTGATCTCGAGATCACGTTCTCGAAACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010304.3-1105s1c1
Sequence:CCGGGACGGACATCCTGGAAGATAACTCGAGTTATCTTCCAGGATGTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010304.3-1641s1c1
Sequence:CCGGGCAGGAGGATTTCTGTGAGTTCTCGAGAACTCACAGAAATCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010304.3-430s1c1
Sequence:CCGGCGGGAAGAGTACGTTCATCAACTCGAGTTGATGAACGTACTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010304
GNA15 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010304.3-932s1c1
Sequence:CCGGCACTGTTTCGAGAACGTGATTCTCGAGAATCACGTTCTCGAAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010304.3-931s1c1
Sequence:CCGGTCACTGTTTCGAGAACGTGATCTCGAGATCACGTTCTCGAAACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010304.3-1105s1c1
Sequence:CCGGGACGGACATCCTGGAAGATAACTCGAGTTATCTTCCAGGATGTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010304.3-1641s1c1
Sequence:CCGGGCAGGAGGATTTCTGTGAGTTCTCGAGAACTCACAGAAATCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010304.3-430s1c1
Sequence:CCGGCGGGAAGAGTACGTTCATCAACTCGAGTTGATGAACGTACTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010304
GNA15 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010304.3-932s1c1
Sequence:CCGGCACTGTTTCGAGAACGTGATTCTCGAGAATCACGTTCTCGAAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010304.3-931s1c1
Sequence:CCGGTCACTGTTTCGAGAACGTGATCTCGAGATCACGTTCTCGAAACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010304.3-1105s1c1
Sequence:CCGGGACGGACATCCTGGAAGATAACTCGAGTTATCTTCCAGGATGTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010304.3-1641s1c1
Sequence:CCGGGCAGGAGGATTTCTGTGAGTTCTCGAGAACTCACAGAAATCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010304.3-430s1c1
Sequence:CCGGCGGGAAGAGTACGTTCATCAACTCGAGTTGATGAACGTACTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks