EMAIL THIS PAGE TO A FRIEND

GNAI1

guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1

147 Gene Product Result for
Synonyms: Gi
Gene ID:
Human(2770) Summary: Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(14677) guanine nucleotide binding protein (G protein), alpha inhibiting 1
Rat(25686) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
Zebrafish(393946) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
domestic cat(101092837) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
cow(281790) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
domestic cat(100500723) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
dog(478227) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
chicken(396368) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
sheep(101116393) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
domestic guinea pig(100135528) guanine nucleotide binding protein (G protein), alpha inhibiting 1
naked mole-rat(101702965) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100936 Anti-GNAI1 antibody produced in rabbit affinity isolated antibody human, mouse, pig, rabbit, goat, yeast, bovine, guinea pig, rat, horse, sheep
western blot pricing
HPA042141 Anti-GNAI1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0002770M1 Monoclonal Anti-GNAI1 antibody produced in mouse clone 2B8-2A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002069 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002069 Rosetta Predictions human pricing
NM_013145 Rosetta Predictions rat pricing
NM_010305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040437 predicted 848
2 SASI_Hs01_00040438 predicted 563
3 SASI_Hs01_00040439 predicted 724
4 SASI_Hs01_00040440 predicted 706
5 SASI_Hs01_00040441 predicted 738
6 SASI_Hs01_00040442 predicted 698
7 SASI_Hs01_00040443 predicted 1235
8 SASI_Hs01_00040444 predicted 789
9 SASI_Hs01_00040445 predicted 1197
10 SASI_Hs02_00333144 predicted 723
11 SASI_Hs01_00040446 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051484 predicted 967
2 SASI_Rn02_00260943 predicted 729
3 SASI_Rn01_00051486 predicted 1241
4 SASI_Rn01_00051487 predicted 1130
5 SASI_Rn01_00051488 predicted 672
6 SASI_Rn01_00051489 predicted 1165
7 SASI_Rn01_00051490 predicted 1158
8 SASI_Rn02_00260944 predicted 1126
9 SASI_Rn01_00051491 predicted 1230
10 SASI_Rn01_00051492 predicted 1067
11 SASI_Rn01_00051485 predicted 764
12 SASI_Rn01_00051493 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131507 predicted 377
2 SASI_Mm01_00131508 predicted 1393
3 SASI_Mm01_00131509 predicted 769
4 SASI_Mm01_00131510 predicted 709
5 SASI_Mm02_00318275 predicted 1406
6 SASI_Mm01_00131511 predicted 541
7 SASI_Mm01_00131512 predicted 725
8 SASI_Mm01_00131513 predicted 1336
9 SASI_Mm01_00131514 predicted 440
10 SASI_Mm01_00131515 predicted 1300
11 SASI_Mm01_00131516 predicted 1346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002069
VALIDATED
GNAI1 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002069.5-1432s21c1
Sequence:CCGGCAAACCAAATGAGTACTTATACTCGAGTATAAGTACTCATTTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002069.5-783s21c1
Sequence:CCGGATGATTCTGCAGCATACTATTCTCGAGAATAGTATGCTGCAGAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002069.5-1622s21c1
Sequence:CCGGTTAAAGCTGGGCTCTAGTATACTCGAGTATACTAGAGCCCAGCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002069.5-1788s21c1
Sequence:CCGGTACTGAATGACAGACTATTACCTCGAGGTAATAGTCTGTCATTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002069.4-571s1c1
Sequence:CCGGCCAGTCAATTATTGCTATCATCTCGAGATGATAGCAATAATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002069.4-527s1c1
Sequence:CCGGGAGGAGTGTAAACAATACAAACTCGAGTTTGTATTGTTTACACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002069.4-992s1c1
Sequence:CCGGACGGCGATCATCTTCTGTGTACTCGAGTACACAGAAGATGATCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002069.4-1208s1c1
Sequence:CCGGGCAGGATCAAACACATATGAACTCGAGTTCATATGTGTTTGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002069
VALIDATED
GNAI1 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002069.5-1432s21c1
Sequence:CCGGCAAACCAAATGAGTACTTATACTCGAGTATAAGTACTCATTTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002069.5-783s21c1
Sequence:CCGGATGATTCTGCAGCATACTATTCTCGAGAATAGTATGCTGCAGAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002069.5-1622s21c1
Sequence:CCGGTTAAAGCTGGGCTCTAGTATACTCGAGTATACTAGAGCCCAGCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002069.5-1788s21c1
Sequence:CCGGTACTGAATGACAGACTATTACCTCGAGGTAATAGTCTGTCATTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002069.4-571s1c1
Sequence:CCGGCCAGTCAATTATTGCTATCATCTCGAGATGATAGCAATAATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002069.4-527s1c1
Sequence:CCGGGAGGAGTGTAAACAATACAAACTCGAGTTTGTATTGTTTACACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002069.4-992s1c1
Sequence:CCGGACGGCGATCATCTTCTGTGTACTCGAGTACACAGAAGATGATCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002069.4-1208s1c1
Sequence:CCGGGCAGGATCAAACACATATGAACTCGAGTTCATATGTGTTTGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002069
VALIDATED
GNAI1 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002069.5-1432s21c1
Sequence:CCGGCAAACCAAATGAGTACTTATACTCGAGTATAAGTACTCATTTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002069.5-783s21c1
Sequence:CCGGATGATTCTGCAGCATACTATTCTCGAGAATAGTATGCTGCAGAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002069.5-1622s21c1
Sequence:CCGGTTAAAGCTGGGCTCTAGTATACTCGAGTATACTAGAGCCCAGCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002069.5-1788s21c1
Sequence:CCGGTACTGAATGACAGACTATTACCTCGAGGTAATAGTCTGTCATTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002069.4-571s1c1
Sequence:CCGGCCAGTCAATTATTGCTATCATCTCGAGATGATAGCAATAATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002069.4-527s1c1
Sequence:CCGGGAGGAGTGTAAACAATACAAACTCGAGTTTGTATTGTTTACACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002069.4-992s1c1
Sequence:CCGGACGGCGATCATCTTCTGTGTACTCGAGTACACAGAAGATGATCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002069.4-1208s1c1
Sequence:CCGGGCAGGATCAAACACATATGAACTCGAGTTCATATGTGTTTGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010305
GNAI1 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010305.1-1257s21c1
Sequence:CCGGCTGTAACAGACGTCATCATAACTCGAGTTATGATGACGTCTGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010305.1-811s21c1
Sequence:CCGGTACCTTCAAAGATCTTCATTTCTCGAGAAATGAAGATCTTTGAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010305.1-1340s21c1
Sequence:CCGGCCAACAGATGAGTACTTATATCTCGAGATATAAGTACTCATCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010305.1-1160s21c1
Sequence:CCGGCAGTTTGAAGACCTCAATAAACTCGAGTTTATTGAGGTCTTCAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010305.1-690s21c1
Sequence:CCGGACGATTCGGCAGCGTACTATCCTCGAGGATAGTACGCTGCCGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010305.1-371s1c1
Sequence:CCGGGAATCTGGAAAGAGTACCATTCTCGAGAATGGTACTCTTTCCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010305
GNAI1 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010305.1-1257s21c1
Sequence:CCGGCTGTAACAGACGTCATCATAACTCGAGTTATGATGACGTCTGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010305.1-811s21c1
Sequence:CCGGTACCTTCAAAGATCTTCATTTCTCGAGAAATGAAGATCTTTGAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010305.1-1340s21c1
Sequence:CCGGCCAACAGATGAGTACTTATATCTCGAGATATAAGTACTCATCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010305.1-1160s21c1
Sequence:CCGGCAGTTTGAAGACCTCAATAAACTCGAGTTTATTGAGGTCTTCAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010305.1-690s21c1
Sequence:CCGGACGATTCGGCAGCGTACTATCCTCGAGGATAGTACGCTGCCGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010305.1-371s1c1
Sequence:CCGGGAATCTGGAAAGAGTACCATTCTCGAGAATGGTACTCTTTCCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010305
GNAI1 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010305.1-1257s21c1
Sequence:CCGGCTGTAACAGACGTCATCATAACTCGAGTTATGATGACGTCTGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010305.1-811s21c1
Sequence:CCGGTACCTTCAAAGATCTTCATTTCTCGAGAAATGAAGATCTTTGAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010305.1-1340s21c1
Sequence:CCGGCCAACAGATGAGTACTTATATCTCGAGATATAAGTACTCATCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010305.1-1160s21c1
Sequence:CCGGCAGTTTGAAGACCTCAATAAACTCGAGTTTATTGAGGTCTTCAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010305.1-690s21c1
Sequence:CCGGACGATTCGGCAGCGTACTATCCTCGAGGATAGTACGCTGCCGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010305.1-371s1c1
Sequence:CCGGGAATCTGGAAAGAGTACCATTCTCGAGAATGGTACTCTTTCCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks