EMAIL THIS PAGE TO A FRIEND

GNAI3

guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3

171 Gene Product Result for
Synonyms: 87U6 ARCND1
UniProtKB ID: P08754, P17539
Gene ID:
Human(2773) Summary: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling pathways. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes an alpha subunit and belongs to the G-alpha family. Mutation in this gene, resulting in a gly40-to-arg substitution, is associated with auriculocondylar syndrome, and shown to affect downstream targets in the G protein-coupled endothelin receptor pathway. [provided by RefSeq, Jun 2012]
Mouse(14679) guanine nucleotide binding protein (G protein), alpha inhibiting 3
Rat(25643) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
Zebrafish(100006888) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
domestic cat(101100320) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
Horse(100058238) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
cow(539521) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
domestic cat(100500725) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
dog(611810) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
chicken(374097) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
sheep(101103693) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
Domestic Rabbit(100359147) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
domestic guinea pig(100135530) guanine nucleotide binding protein (G protein), alpha inhibiting 3
naked mole-rat(101703043) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006496 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006496 Rosetta Predictions human pricing
NM_013106 Rosetta Predictions rat pricing
NM_010306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341697 predicted 1203
2 SASI_Hs01_00129967 predicted 1304
3 SASI_Hs01_00129968 predicted 1191
4 SASI_Hs01_00129969 predicted 457
5 SASI_Hs01_00129970 predicted 1021
6 SASI_Hs01_00129971 predicted 377
7 SASI_Hs01_00129972 predicted 1049
8 SASI_Hs01_00129973 predicted 331
9 SASI_Hs01_00129974 predicted 646
10 SASI_Hs01_00129975 predicted 318
11 SASI_Hs01_00129966 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040645 predicted 523
2 SASI_Rn01_00040647 predicted 577
3 SASI_Rn01_00040648 predicted 445
4 SASI_Rn01_00040649 predicted 545
5 SASI_Rn01_00040650 predicted 652
6 SASI_Rn02_00260880 predicted 306
7 SASI_Rn01_00040651 predicted 595
8 SASI_Rn01_00040652 predicted 953
9 SASI_Rn01_00040653 predicted 278
10 SASI_Rn01_00040654 predicted 761
11 SASI_Rn01_00040646 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318276 predicted 1012
2 SASI_Mm01_00043940 predicted 829
3 SASI_Mm01_00043941 predicted 537
4 SASI_Mm01_00043942 predicted 600
5 SASI_Mm01_00043944 predicted 515
6 SASI_Mm01_00043945 predicted 1205
7 SASI_Mm01_00043947 predicted 628
8 SASI_Mm02_00318277 predicted 568
9 SASI_Mm02_00318278 predicted 890
10 SASI_Mm02_00318279 predicted 1146
11 SASI_Mm01_00043938 predicted 572
12 SASI_Mm01_00043939 predicted 298
13 SASI_Mm01_00043943 predicted 476
14 SASI_Mm01_00043946 predicted 406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010306
VALIDATED
GNAI3 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010306.2-1010s21c1
Sequence:CCGGGCTTACATTCAGTGCCAGTTTCTCGAGAAACTGGCACTGAATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010306.2-1122s21c1
Sequence:CCGGCTGTTACGGATGTCATCATTACTCGAGTAATGATGACATCCGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010306.2-949s21c1
Sequence:CCGGGAGTCCATTAACAATCTGTTACTCGAGTAACAGATTGTTAATGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010306.2-1610s21c1
Sequence:CCGGGCACACAATGTCACCAGACATCTCGAGATGTCTGGTGACATTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010306.2-479s21c1
Sequence:CCGGGCAGGCGTGATTAAACGTTTACTCGAGTAAACGTTTAATCACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010306.1-1610s1c1
Sequence:CCGGGCACACAATGTCACCAGACATCTCGAGATGTCTGGTGACATTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010306.1-949s1c1
Sequence:CCGGGAGTCCATTAACAATCTGTTACTCGAGTAACAGATTGTTAATGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010306.1-479s1c1
Sequence:CCGGGCAGGCGTGATTAAACGTTTACTCGAGTAAACGTTTAATCACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010306.1-1122s1c1
Sequence:CCGGCTGTTACGGATGTCATCATTACTCGAGTAATGATGACATCCGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010306.1-1010s1c1
Sequence:CCGGGCTTACATTCAGTGCCAGTTTCTCGAGAAACTGGCACTGAATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010306
VALIDATED
GNAI3 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010306.2-1010s21c1
Sequence:CCGGGCTTACATTCAGTGCCAGTTTCTCGAGAAACTGGCACTGAATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010306.2-1122s21c1
Sequence:CCGGCTGTTACGGATGTCATCATTACTCGAGTAATGATGACATCCGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010306.2-949s21c1
Sequence:CCGGGAGTCCATTAACAATCTGTTACTCGAGTAACAGATTGTTAATGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010306.2-1610s21c1
Sequence:CCGGGCACACAATGTCACCAGACATCTCGAGATGTCTGGTGACATTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010306.2-479s21c1
Sequence:CCGGGCAGGCGTGATTAAACGTTTACTCGAGTAAACGTTTAATCACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010306.1-1610s1c1
Sequence:CCGGGCACACAATGTCACCAGACATCTCGAGATGTCTGGTGACATTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010306.1-949s1c1
Sequence:CCGGGAGTCCATTAACAATCTGTTACTCGAGTAACAGATTGTTAATGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010306.1-479s1c1
Sequence:CCGGGCAGGCGTGATTAAACGTTTACTCGAGTAAACGTTTAATCACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010306.1-1122s1c1
Sequence:CCGGCTGTTACGGATGTCATCATTACTCGAGTAATGATGACATCCGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010306.1-1010s1c1
Sequence:CCGGGCTTACATTCAGTGCCAGTTTCTCGAGAAACTGGCACTGAATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010306
VALIDATED
GNAI3 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010306.2-1010s21c1
Sequence:CCGGGCTTACATTCAGTGCCAGTTTCTCGAGAAACTGGCACTGAATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010306.2-1122s21c1
Sequence:CCGGCTGTTACGGATGTCATCATTACTCGAGTAATGATGACATCCGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010306.2-949s21c1
Sequence:CCGGGAGTCCATTAACAATCTGTTACTCGAGTAACAGATTGTTAATGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010306.2-1610s21c1
Sequence:CCGGGCACACAATGTCACCAGACATCTCGAGATGTCTGGTGACATTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010306.2-479s21c1
Sequence:CCGGGCAGGCGTGATTAAACGTTTACTCGAGTAAACGTTTAATCACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010306.1-1610s1c1
Sequence:CCGGGCACACAATGTCACCAGACATCTCGAGATGTCTGGTGACATTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010306.1-949s1c1
Sequence:CCGGGAGTCCATTAACAATCTGTTACTCGAGTAACAGATTGTTAATGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010306.1-479s1c1
Sequence:CCGGGCAGGCGTGATTAAACGTTTACTCGAGTAAACGTTTAATCACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010306.1-1122s1c1
Sequence:CCGGCTGTTACGGATGTCATCATTACTCGAGTAATGATGACATCCGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010306.1-1010s1c1
Sequence:CCGGGCTTACATTCAGTGCCAGTTTCTCGAGAAACTGGCACTGAATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006496
VALIDATED
GNAI3 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006496.2-598s21c1
Sequence:CCGGGCTCAATGATTCTGCTTCATACTCGAGTATGAAGCAGAATCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006496.2-527s21c1
Sequence:CCGGGCAGGAGTGATTAAACGGTTACTCGAGTAACCGTTTAATCACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006496.2-942s21c1
Sequence:CCGGCTTCAATCATTCTCTTCCTTACTCGAGTAAGGAAGAGAATGATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006496.2-833s21c1
Sequence:CCGGGCCCTCAGTGATTATGACCTTCTCGAGAAGGTCATAATCACTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006496.1-483s1c1
Sequence:CCGGGCTCAATGATTCTGCTTCATACTCGAGTATGAAGCAGAATCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006496.1-412s1c1
Sequence:CCGGGCAGGAGTGATTAAACGGTTACTCGAGTAACCGTTTAATCACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006496.1-1083s1c1
Sequence:CCGGCTTAAAGGAATGTGGACTTTACTCGAGTAAAGTCCACATTCCTTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006496.1-827s1c1
Sequence:CCGGCTTCAATCATTCTCTTCCTTACTCGAGTAAGGAAGAGAATGATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006496.1-718s1c1
Sequence:CCGGGCCCTCAGTGATTATGACCTTCTCGAGAAGGTCATAATCACTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006496
VALIDATED
GNAI3 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006496.2-598s21c1
Sequence:CCGGGCTCAATGATTCTGCTTCATACTCGAGTATGAAGCAGAATCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006496.2-527s21c1
Sequence:CCGGGCAGGAGTGATTAAACGGTTACTCGAGTAACCGTTTAATCACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006496.2-942s21c1
Sequence:CCGGCTTCAATCATTCTCTTCCTTACTCGAGTAAGGAAGAGAATGATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006496.2-833s21c1
Sequence:CCGGGCCCTCAGTGATTATGACCTTCTCGAGAAGGTCATAATCACTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006496.1-483s1c1
Sequence:CCGGGCTCAATGATTCTGCTTCATACTCGAGTATGAAGCAGAATCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006496.1-412s1c1
Sequence:CCGGGCAGGAGTGATTAAACGGTTACTCGAGTAACCGTTTAATCACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006496.1-1083s1c1
Sequence:CCGGCTTAAAGGAATGTGGACTTTACTCGAGTAAAGTCCACATTCCTTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006496.1-827s1c1
Sequence:CCGGCTTCAATCATTCTCTTCCTTACTCGAGTAAGGAAGAGAATGATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006496.1-718s1c1
Sequence:CCGGGCCCTCAGTGATTATGACCTTCTCGAGAAGGTCATAATCACTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006496
VALIDATED
GNAI3 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006496.2-598s21c1
Sequence:CCGGGCTCAATGATTCTGCTTCATACTCGAGTATGAAGCAGAATCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006496.2-527s21c1
Sequence:CCGGGCAGGAGTGATTAAACGGTTACTCGAGTAACCGTTTAATCACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006496.2-942s21c1
Sequence:CCGGCTTCAATCATTCTCTTCCTTACTCGAGTAAGGAAGAGAATGATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006496.2-833s21c1
Sequence:CCGGGCCCTCAGTGATTATGACCTTCTCGAGAAGGTCATAATCACTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006496.1-483s1c1
Sequence:CCGGGCTCAATGATTCTGCTTCATACTCGAGTATGAAGCAGAATCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006496.1-412s1c1
Sequence:CCGGGCAGGAGTGATTAAACGGTTACTCGAGTAACCGTTTAATCACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006496.1-1083s1c1
Sequence:CCGGCTTAAAGGAATGTGGACTTTACTCGAGTAAAGTCCACATTCCTTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006496.1-827s1c1
Sequence:CCGGCTTCAATCATTCTCTTCCTTACTCGAGTAAGGAAGAGAATGATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006496.1-718s1c1
Sequence:CCGGGCCCTCAGTGATTATGACCTTCTCGAGAAGGTCATAATCACTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks