EMAIL THIS PAGE TO A FRIEND

GNAL

guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type

97 Gene Product Result for
Synonyms: DYT25
UniProtKB ID: P38405, B7ZA26, Q86XU3
Gene ID:
Mouse(14680) guanine nucleotide binding protein, alpha stimulating, olfactory type
Rat(24611) guanine nucleotide binding protein, alpha stimulating, olfactory type
Zebrafish(492467) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
domestic cat(101098171) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
cow(100124520) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
dog(607658) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
chicken(474379) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
domestic guinea pig(100716796) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
naked mole-rat(101718578) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
sheep(101105461) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
Domestic Rabbit(100348829) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405880 Anti-GNAL antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2100939 Anti-GNAL antibody produced in rabbit affinity isolated antibody bovine, zebrafish, rat, rabbit, canine, human, mouse, guinea pig, horse, pig
western blot pricing
SAB4501222 Anti-GNAL antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002071 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002071 Rosetta Predictions human pricing
NM_182978 Rosetta Predictions human pricing
XM_001060701 Rosetta Predictions rat pricing
XM_001060758 Rosetta Predictions rat pricing
XM_341626 Rosetta Predictions rat pricing
NM_010307 Rosetta Predictions mouse pricing
NM_177137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073571 predicted 816
2 SASI_Hs01_00073572 predicted 976
3 SASI_Hs01_00073573 predicted 980
4 SASI_Hs01_00073574 predicted 1060
5 SASI_Hs01_00073575 predicted 799
6 SASI_Hs01_00073576 predicted 1146
7 SASI_Hs01_00073577 predicted 1025
8 SASI_Hs01_00073578 predicted 1067
9 SASI_Hs01_00073579 predicted 958
10 SASI_Hs01_00073580 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046098 predicted 1091
2 SASI_Hs01_00046099 predicted 1249
3 SASI_Hs01_00046100 predicted 1252
4 SASI_Hs01_00046101 predicted 1337
5 SASI_Hs01_00046102 predicted 1081
6 SASI_Hs01_00046103 predicted 1421
7 SASI_Hs01_00046104 predicted 1306
8 SASI_Hs01_00046105 predicted 1346
9 SASI_Hs01_00046106 predicted 1236
10 SASI_Hs01_00046107 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297412 predicted 1212
2 SASI_Rn02_00297413 predicted 632
3 SASI_Rn02_00297414 predicted 1441
4 SASI_Rn02_00297415 predicted 1281
5 SASI_Rn02_00297416 predicted 952
6 SASI_Rn02_00297417 predicted 1283
7 SASI_Rn02_00297418 predicted 1146
8 SASI_Rn02_00297419 predicted 714
9 SASI_Rn02_00297420 predicted 803
10 SASI_Rn02_00297421 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297631 predicted 1616
2 SASI_Rn02_00297632 predicted 1035
3 SASI_Rn02_00297633 predicted 1843
4 SASI_Rn02_00297634 predicted 1684
5 SASI_Rn02_00297635 predicted 1351
6 SASI_Rn02_00297636 predicted 1685
7 SASI_Rn02_00297637 predicted 1547
8 SASI_Rn02_00297638 predicted 1121
9 SASI_Rn02_00297639 predicted 1206
10 SASI_Rn02_00297640 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393169 predicted 1214
2 SASI_Rn02_00393170 predicted 637
3 SASI_Rn02_00393171 predicted 1441
4 SASI_Rn02_00393172 predicted 1278
5 SASI_Rn02_00393173 predicted 951
6 SASI_Rn02_00393174 predicted 1282
7 SASI_Rn02_00393175 predicted 1148
8 SASI_Rn02_00393176 predicted 712
9 SASI_Rn02_00393177 predicted 808
10 SASI_Rn02_00393178 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191503 predicted 903
2 SASI_Mm02_00318280 predicted 821
3 SASI_Mm02_00318281 predicted 901
4 SASI_Mm01_00191505 predicted 551
5 SASI_Mm01_00191509 predicted 769
6 SASI_Mm01_00191510 predicted 433
7 SASI_Mm01_00191511 predicted 817
8 SASI_Mm01_00191512 predicted 575
9 SASI_Mm02_00318282 predicted 755
10 SASI_Mm02_00318283 predicted 744
11 SASI_Mm01_00191504 predicted 561
12 SASI_Mm01_00191506 predicted 730
13 SASI_Mm01_00191507 predicted 438
14 SASI_Mm01_00191508 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082518 predicted 1292
2 SASI_Mm02_00347131 predicted 1212
3 SASI_Mm02_00347132 predicted 1296
4 SASI_Mm02_00347133 predicted 435
5 SASI_Mm01_00082520 predicted 940
6 SASI_Mm01_00082524 predicted 1167
7 SASI_Mm01_00082525 predicted 818
8 SASI_Mm01_00082526 predicted 1201
9 SASI_Mm01_00082527 predicted 962
10 SASI_Mm02_00347134 predicted 1149
11 SASI_Mm01_00082519 predicted 962
12 SASI_Mm01_00082521 predicted 1132
13 SASI_Mm01_00082522 predicted 837
14 SASI_Mm01_00082523 predicted 812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002071
GNAL MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-1377s1c1
Sequence:CCGGCCTCAAGCAGTATGAGCTCTTCTCGAGAAGAGCTCATACTGCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-588s1c1
Sequence:CCGGCCAATTTCGATCAGACTACATCTCGAGATGTAGTCTGATCGAAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-926s1c1
Sequence:CCGGGCTTTAACGATGTCACAGCTACTCGAGTAGCTGTGACATCGTTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-1162s1c1
Sequence:CCGGGCAAATTATACTGTTCCTGAACTCGAGTTCAGGAACAGTATAATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-701s1c1
Sequence:CCGGGCTTTGAGAGATCCAACGAATCTCGAGATTCGTTGGATCTCTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1584s21c1
Sequence:CCGGGTAGCTACAACATGGTGATTCCTCGAGGAATCACCATGTTGTAGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1065s21c1
Sequence:CCGGTGCACGTCAATGGGTTTAATCCTCGAGGATTAAACCCATTGACGTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1151s21c1
Sequence:CCGGGTTTCAGCAATGAGTACTATACTCGAGTATAGTACTCATTGCTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1343s21c1
Sequence:CCGGCTGATTGACTGTGCACAATACCTCGAGGTATTGTGCACAGTCAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1885s21c1
Sequence:CCGGCACCGGTGACGGCAAACATTACTCGAGTAATGTTTGCCGTCACCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002071
GNAL MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-1377s1c1
Sequence:CCGGCCTCAAGCAGTATGAGCTCTTCTCGAGAAGAGCTCATACTGCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-588s1c1
Sequence:CCGGCCAATTTCGATCAGACTACATCTCGAGATGTAGTCTGATCGAAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-926s1c1
Sequence:CCGGGCTTTAACGATGTCACAGCTACTCGAGTAGCTGTGACATCGTTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-1162s1c1
Sequence:CCGGGCAAATTATACTGTTCCTGAACTCGAGTTCAGGAACAGTATAATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-701s1c1
Sequence:CCGGGCTTTGAGAGATCCAACGAATCTCGAGATTCGTTGGATCTCTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1584s21c1
Sequence:CCGGGTAGCTACAACATGGTGATTCCTCGAGGAATCACCATGTTGTAGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1065s21c1
Sequence:CCGGTGCACGTCAATGGGTTTAATCCTCGAGGATTAAACCCATTGACGTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1151s21c1
Sequence:CCGGGTTTCAGCAATGAGTACTATACTCGAGTATAGTACTCATTGCTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1343s21c1
Sequence:CCGGCTGATTGACTGTGCACAATACCTCGAGGTATTGTGCACAGTCAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1885s21c1
Sequence:CCGGCACCGGTGACGGCAAACATTACTCGAGTAATGTTTGCCGTCACCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002071
GNAL MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-1377s1c1
Sequence:CCGGCCTCAAGCAGTATGAGCTCTTCTCGAGAAGAGCTCATACTGCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-588s1c1
Sequence:CCGGCCAATTTCGATCAGACTACATCTCGAGATGTAGTCTGATCGAAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-926s1c1
Sequence:CCGGGCTTTAACGATGTCACAGCTACTCGAGTAGCTGTGACATCGTTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-1162s1c1
Sequence:CCGGGCAAATTATACTGTTCCTGAACTCGAGTTCAGGAACAGTATAATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002071.1-701s1c1
Sequence:CCGGGCTTTGAGAGATCCAACGAATCTCGAGATTCGTTGGATCTCTCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1584s21c1
Sequence:CCGGGTAGCTACAACATGGTGATTCCTCGAGGAATCACCATGTTGTAGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1065s21c1
Sequence:CCGGTGCACGTCAATGGGTTTAATCCTCGAGGATTAAACCCATTGACGTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1151s21c1
Sequence:CCGGGTTTCAGCAATGAGTACTATACTCGAGTATAGTACTCATTGCTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1343s21c1
Sequence:CCGGCTGATTGACTGTGCACAATACCTCGAGGTATTGTGCACAGTCAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002071.3-1885s21c1
Sequence:CCGGCACCGGTGACGGCAAACATTACTCGAGTAATGTTTGCCGTCACCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010307
GNAL MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-732s1c1
Sequence:CCGGCCGGGAAGATAACAATACCAACTCGAGTTGGTATTGTTATCTTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-588s1c1
Sequence:CCGGGACACGATTCCAAGTGGACAACTCGAGTTGTCCACTTGGAATCGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-907s1c1
Sequence:CCGGGCCAATTATACTGTCCCTGAACTCGAGTTCAGGGACAGTATAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-970s1c1
Sequence:CCGGGCAAAGTTCTTTATCCGGGATCTCGAGATCCCGGATAAAGAACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-270s1c1
Sequence:CCGGCGTGACAATCGTTTCAGCAATCTCGAGATTGCTGAAACGATTGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010307
GNAL MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-732s1c1
Sequence:CCGGCCGGGAAGATAACAATACCAACTCGAGTTGGTATTGTTATCTTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-588s1c1
Sequence:CCGGGACACGATTCCAAGTGGACAACTCGAGTTGTCCACTTGGAATCGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-907s1c1
Sequence:CCGGGCCAATTATACTGTCCCTGAACTCGAGTTCAGGGACAGTATAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-970s1c1
Sequence:CCGGGCAAAGTTCTTTATCCGGGATCTCGAGATCCCGGATAAAGAACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-270s1c1
Sequence:CCGGCGTGACAATCGTTTCAGCAATCTCGAGATTGCTGAAACGATTGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010307
GNAL MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-732s1c1
Sequence:CCGGCCGGGAAGATAACAATACCAACTCGAGTTGGTATTGTTATCTTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-588s1c1
Sequence:CCGGGACACGATTCCAAGTGGACAACTCGAGTTGTCCACTTGGAATCGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-907s1c1
Sequence:CCGGGCCAATTATACTGTCCCTGAACTCGAGTTCAGGGACAGTATAATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-970s1c1
Sequence:CCGGGCAAAGTTCTTTATCCGGGATCTCGAGATCCCGGATAAAGAACTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010307.1-270s1c1
Sequence:CCGGCGTGACAATCGTTTCAGCAATCTCGAGATTGCTGAAACGATTGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)