EMAIL THIS PAGE TO A FRIEND

GNAO1

guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O

118 Gene Product Result for
Synonyms: G-ALPHA-o GNAO
UniProtKB ID: P09471, P29777, Q8TD72, Q9UMV4
Gene ID:
Mouse(14681) guanine nucleotide binding protein, alpha O
Rat(50664) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
chicken(415698) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
domestic cat(101101353) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
Horse(100051282) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
cow(281792) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
dog(609157) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
sheep(101119495) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
domestic guinea pig(100716648) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
naked mole-rat(101723580) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020988 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020988 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020988 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010308 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010308 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010308 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067621 MISSION® esiRNA esiRNA human GNAO1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020988 Rosetta Predictions human pricing
NM_138736 Rosetta Predictions human pricing
NM_017327 Rosetta Predictions rat pricing
NM_001113384 Rosetta Predictions mouse pricing
NM_010308 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354440 predicted 1161
2 SASI_Hs01_00144357 predicted 1185
3 SASI_Hs02_00354441 predicted 1329
4 SASI_Hs02_00354442 predicted 1082
5 SASI_Hs02_00354443 predicted 1156
6 SASI_Hs02_00354444 predicted 1103
7 SASI_Hs02_00354445 predicted 1205
8 SASI_Hs01_00144363 predicted 1090
9 SASI_Hs01_00144358 predicted 1312
10 SASI_Hs01_00144366 predicted 1155
11 SASI_Hs01_00144359 predicted 311
12 SASI_Hs01_00144360 predicted 273
13 SASI_Hs01_00144361 predicted 277
14 SASI_Hs01_00144362 predicted 430
15 SASI_Hs01_00144364 predicted 464
16 SASI_Hs01_00144365 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363851 predicted 1156
2 SASI_Hs01_00236471 predicted 1185
3 SASI_Hs02_00363852 predicted 1334
4 SASI_Hs02_00363853 predicted 1075
5 SASI_Hs02_00363854 predicted 1155
6 SASI_Hs02_00363855 predicted 1104
7 SASI_Hs02_00363856 predicted 1198
8 SASI_Hs01_00236477 predicted 1093
9 SASI_Hs01_00236472 predicted 1315
10 SASI_Hs01_00236480 predicted 1150
11 SASI_Hs01_00236473 predicted 306
12 SASI_Hs01_00236474 predicted 280
13 SASI_Hs01_00236475 predicted 276
14 SASI_Hs01_00236476 predicted 436
15 SASI_Hs01_00236478 predicted 472
16 SASI_Hs01_00236479 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100493 predicted 1690
2 SASI_Rn02_00261781 predicted 1684
3 SASI_Rn01_00100494 predicted 947
4 SASI_Rn01_00100495 predicted 880
5 SASI_Rn01_00100496 predicted 1277
6 SASI_Rn01_00100497 predicted 1053
7 SASI_Rn02_00261782 predicted 886
8 SASI_Rn01_00100498 predicted 1555
9 SASI_Rn01_00100499 predicted 1067
10 SASI_Rn02_00261783 predicted 947
11 SASI_Rn01_00100491 predicted 1775
12 SASI_Rn01_00100492 predicted 1614
13 SASI_Rn01_00100500 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307608 predicted 763
2 SASI_Mm02_00307609 predicted 843
3 SASI_Mm02_00307610 predicted 814
4 SASI_Mm02_00307611 predicted 820
5 SASI_Mm02_00307612 predicted 693
6 SASI_Mm02_00307613 predicted 758
7 SASI_Mm02_00307614 predicted 973
8 SASI_Mm02_00307615 predicted 919
9 SASI_Mm02_00307616 predicted 824
10 SASI_Mm02_00307617 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146143 predicted 755
2 SASI_Mm01_00146147 predicted 839
3 SASI_Mm01_00146148 predicted 812
4 SASI_Mm01_00146149 predicted 819
5 SASI_Mm01_00146152 predicted 698
6 SASI_Mm02_00318284 predicted 754
7 SASI_Mm02_00318285 predicted 978
8 SASI_Mm02_00318286 predicted 917
9 SASI_Mm02_00318287 predicted 826
10 SASI_Mm02_00318288 predicted 859
11 SASI_Mm01_00146144 predicted 1222
12 SASI_Mm01_00146145 predicted 1353
13 SASI_Mm01_00146146 predicted 846
14 SASI_Mm01_00146150 predicted 1903
15 SASI_Mm01_00146151 predicted 1898
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020988
GNAO1 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020988.2-1547s21c1
Sequence:CCGGAGGACGTCACGGCCATCATTTCTCGAGAAATGATGGCCGTGACGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020988.2-2152s21c1
Sequence:CCGGTTAGTTGAGTCTTCACATTTACTCGAGTAAATGTGAAGACTCAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-88s1c1
Sequence:CCGGGCCGCCAAAGACGTGAAATTACTCGAGTAATTTCACGTCTTTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-747s1c1
Sequence:CCGGGCTCTTCGACTCCATCTGTAACTCGAGTTACAGATGGAGTCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-272s1c1
Sequence:CCGGTGGGCATCGAATATGGTGATACTCGAGTATCACCATATTCGATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-937s1c1
Sequence:CCGGCGCTCACCCAACAAAGAAATACTCGAGTATTTCTTTGTTGGGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-904s1c1
Sequence:CCGGGCCTACATCCAAGCACAATTTCTCGAGAAATTGTGCTTGGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020988
GNAO1 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020988.2-1547s21c1
Sequence:CCGGAGGACGTCACGGCCATCATTTCTCGAGAAATGATGGCCGTGACGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020988.2-2152s21c1
Sequence:CCGGTTAGTTGAGTCTTCACATTTACTCGAGTAAATGTGAAGACTCAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-88s1c1
Sequence:CCGGGCCGCCAAAGACGTGAAATTACTCGAGTAATTTCACGTCTTTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-747s1c1
Sequence:CCGGGCTCTTCGACTCCATCTGTAACTCGAGTTACAGATGGAGTCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-272s1c1
Sequence:CCGGTGGGCATCGAATATGGTGATACTCGAGTATCACCATATTCGATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-937s1c1
Sequence:CCGGCGCTCACCCAACAAAGAAATACTCGAGTATTTCTTTGTTGGGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-904s1c1
Sequence:CCGGGCCTACATCCAAGCACAATTTCTCGAGAAATTGTGCTTGGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020988
GNAO1 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020988.2-1547s21c1
Sequence:CCGGAGGACGTCACGGCCATCATTTCTCGAGAAATGATGGCCGTGACGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020988.2-2152s21c1
Sequence:CCGGTTAGTTGAGTCTTCACATTTACTCGAGTAAATGTGAAGACTCAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-88s1c1
Sequence:CCGGGCCGCCAAAGACGTGAAATTACTCGAGTAATTTCACGTCTTTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-747s1c1
Sequence:CCGGGCTCTTCGACTCCATCTGTAACTCGAGTTACAGATGGAGTCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-272s1c1
Sequence:CCGGTGGGCATCGAATATGGTGATACTCGAGTATCACCATATTCGATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-937s1c1
Sequence:CCGGCGCTCACCCAACAAAGAAATACTCGAGTATTTCTTTGTTGGGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020988.1-904s1c1
Sequence:CCGGGCCTACATCCAAGCACAATTTCTCGAGAAATTGTGCTTGGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010308
GNAO1 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010308.3-1470s21c1
Sequence:CCGGTTGTGCCACAGACACGAATAACTCGAGTTATTCGTGTCTGTGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010308.3-1850s21c1
Sequence:CCGGCTCACCATTTAATCCATATTTCTCGAGAAATATGGATTAAATGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010308.3-1350s21c1
Sequence:CCGGGACCATCTGCTTTCCCGAATACTCGAGTATTCGGGAAAGCAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010308.3-920s21c1
Sequence:CCGGTCAACCGATCTCGGGAGTATCCTCGAGGATACTCCCGAGATCGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010308.3-586s21c1
Sequence:CCGGGCCGCCAAAGACGTGAAATTACTCGAGTAATTTCACGTCTTTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010308.2-2667s1c1
Sequence:CCGGCGGCTGTGTATTTCTGTAGAACTCGAGTTCTACAGAAATACACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010308.2-1346s1c1
Sequence:CCGGTCACCCTTGACCATCTGCTTTCTCGAGAAAGCAGATGGTCAAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010308.2-932s1c1
Sequence:CCGGTCTCGGGAGTATCAGCTCAATCTCGAGATTGAGCTGATACTCCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010308.2-1439s1c1
Sequence:CCGGCGCTCACCCAACAAAGAAATTCTCGAGAATTTCTTTGTTGGGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010308.2-1488s1c1
Sequence:CCGGCGAATAATATCCAGGTGGTATCTCGAGATACCACCTGGATATTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010308
GNAO1 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010308.3-1470s21c1
Sequence:CCGGTTGTGCCACAGACACGAATAACTCGAGTTATTCGTGTCTGTGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010308.3-1850s21c1
Sequence:CCGGCTCACCATTTAATCCATATTTCTCGAGAAATATGGATTAAATGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010308.3-1350s21c1
Sequence:CCGGGACCATCTGCTTTCCCGAATACTCGAGTATTCGGGAAAGCAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010308.3-920s21c1
Sequence:CCGGTCAACCGATCTCGGGAGTATCCTCGAGGATACTCCCGAGATCGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010308.3-586s21c1
Sequence:CCGGGCCGCCAAAGACGTGAAATTACTCGAGTAATTTCACGTCTTTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010308.2-2667s1c1
Sequence:CCGGCGGCTGTGTATTTCTGTAGAACTCGAGTTCTACAGAAATACACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010308.2-1346s1c1
Sequence:CCGGTCACCCTTGACCATCTGCTTTCTCGAGAAAGCAGATGGTCAAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010308.2-932s1c1
Sequence:CCGGTCTCGGGAGTATCAGCTCAATCTCGAGATTGAGCTGATACTCCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010308.2-1439s1c1
Sequence:CCGGCGCTCACCCAACAAAGAAATTCTCGAGAATTTCTTTGTTGGGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010308.2-1488s1c1
Sequence:CCGGCGAATAATATCCAGGTGGTATCTCGAGATACCACCTGGATATTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010308
GNAO1 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010308.3-1470s21c1
Sequence:CCGGTTGTGCCACAGACACGAATAACTCGAGTTATTCGTGTCTGTGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010308.3-1850s21c1
Sequence:CCGGCTCACCATTTAATCCATATTTCTCGAGAAATATGGATTAAATGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010308.3-1350s21c1
Sequence:CCGGGACCATCTGCTTTCCCGAATACTCGAGTATTCGGGAAAGCAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010308.3-920s21c1
Sequence:CCGGTCAACCGATCTCGGGAGTATCCTCGAGGATACTCCCGAGATCGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010308.3-586s21c1
Sequence:CCGGGCCGCCAAAGACGTGAAATTACTCGAGTAATTTCACGTCTTTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010308.2-2667s1c1
Sequence:CCGGCGGCTGTGTATTTCTGTAGAACTCGAGTTCTACAGAAATACACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010308.2-1346s1c1
Sequence:CCGGTCACCCTTGACCATCTGCTTTCTCGAGAAAGCAGATGGTCAAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010308.2-932s1c1
Sequence:CCGGTCTCGGGAGTATCAGCTCAATCTCGAGATTGAGCTGATACTCCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010308.2-1439s1c1
Sequence:CCGGCGCTCACCCAACAAAGAAATTCTCGAGAATTTCTTTGTTGGGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010308.2-1488s1c1
Sequence:CCGGCGAATAATATCCAGGTGGTATCTCGAGATACCACCTGGATATTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks