EMAIL THIS PAGE TO A FRIEND

GNAS

GNAS complex locus

357 Gene Product Result for
Synonyms: AHO C20orf45 GNAS1 GPSA GSA GSP NESP PHP1A PHP1B PHP1C POH
UniProtKB ID: P84996, A2A2S4
Gene ID:
Human(2778) Summary: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors. [provided by RefSeq, Aug 2012]
Mouse(14683) GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus
Rat(24896) GNAS complex locus
Zebrafish(557353) GNAS complex locus
dog(403943) GNAS complex locus
cow(281793) GNAS complex locus
domestic cat(101098453) GNAS complex locus
chicken(419313) GNAS complex locus
domestic guinea pig(100732436) GNAS complex locus
naked mole-rat(101716905) GNAS complex locus
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41764 Anti-GNAS (AB1) antibody produced in rabbit IgG fraction of antiserum human, rabbit, horse, rabbit, bovine, canine, mouse, rat, guinea pig, pig
western blot pricing
AV41765 Anti-GNAS (AB2) antibody produced in rabbit IgG fraction of antiserum guinea pig, canine, pig, rabbit, human, rabbit, rat, horse, bovine, mouse
western blot pricing
AV42694 Anti-GNAS (AB3) antibody produced in rabbit IgG fraction of antiserum pig, bovine, mouse, rabbit, rabbit, rat, human
immunohistochemistry, western blot pricing
SAB2501411 Anti-GNAS antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, mouse, rat, bovine, human
ELISA, immunofluorescence, western blot pricing
HPA018122 Anti-GNAS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2100941 Anti-GNAS antibody produced in rabbit affinity isolated antibody rabbit, human, bovine, pig, horse, rat, canine, mouse, guinea pig
western blot pricing
HPA027478 Anti-GNAS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunohistochemistry, western blot pricing
HPA028386 Anti-GNAS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000516 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010309 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010309 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010309 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000516 Rosetta Predictions human pricing
NM_001077488 Rosetta Predictions human pricing
NM_001077489 Rosetta Predictions human pricing
NM_001077490 Rosetta Predictions human pricing
NM_016592 Rosetta Predictions human pricing
NM_080425 Rosetta Predictions human pricing
NM_080426 Rosetta Predictions human pricing
NR_003259 Rosetta Predictions human pricing
NM_001024823 Rosetta Predictions rat pricing
NM_019132 Rosetta Predictions rat pricing
NM_021845 Rosetta Predictions rat pricing
NM_001077507 Rosetta Predictions mouse pricing
NM_001077510 Rosetta Predictions mouse pricing
NM_010309 Rosetta Predictions mouse pricing
NM_010310 Rosetta Predictions mouse pricing
NM_019690 Rosetta Predictions mouse pricing
NM_022000 Rosetta Predictions mouse pricing
NM_201616 Rosetta Predictions mouse pricing
NM_201617 Rosetta Predictions mouse pricing
NM_201618 Rosetta Predictions mouse pricing
NR_003258 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246751 predicted 862
2 SASI_Hs01_00246752 predicted 910
3 SASI_Hs01_00246753 predicted 959
4 SASI_Hs01_00246754 predicted 1050
5 SASI_Hs01_00246755 predicted 1517
6 SASI_Hs01_00246756 predicted 1254
7 SASI_Hs01_00246757 predicted 1206
8 SASI_Hs01_00246758 predicted 1301
9 SASI_Hs02_00302707 predicted 952
10 SASI_Hs01_00246760 predicted 1502
11 SASI_Hs01_00246759 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312764 predicted 522
2 SASI_Hs02_00312765 predicted 572
3 SASI_Hs02_00312766 predicted 621
4 SASI_Hs02_00312767 predicted 706
5 SASI_Hs02_00312768 predicted 1181
6 SASI_Hs02_00312769 predicted 912
7 SASI_Hs02_00312770 predicted 874
8 SASI_Hs02_00312771 predicted 962
9 SASI_Hs02_00312772 predicted 615
10 SASI_Hs02_00312773 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312774 predicted 820
2 SASI_Hs02_00312775 predicted 867
3 SASI_Hs02_00312776 predicted 911
4 SASI_Hs02_00312777 predicted 1000
5 SASI_Hs02_00312778 predicted 1472
6 SASI_Hs02_00312779 predicted 1206
7 SASI_Hs02_00312780 predicted 1170
8 SASI_Hs02_00312781 predicted 1250
9 SASI_Hs02_00312782 predicted 911
10 SASI_Hs02_00312783 predicted 1464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312784 predicted 2718
2 SASI_Hs02_00312785 predicted 2773
3 SASI_Hs02_00312786 predicted 2810
4 SASI_Hs02_00312787 predicted 2808
5 SASI_Hs02_00312788 predicted 754
6 SASI_Hs02_00312789 predicted 2630
7 SASI_Hs02_00312790 predicted 2277
8 SASI_Hs02_00312791 predicted 2477
9 SASI_Hs02_00312792 predicted 2090
10 SASI_Hs02_00312793 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093218 predicted 1518
2 SASI_Hs01_00093219 predicted 1564
3 SASI_Hs01_00093220 predicted 1423
4 SASI_Hs01_00093221 predicted 659
5 SASI_Hs01_00093222 predicted 1274
6 SASI_Hs01_00093223 predicted 406
7 SASI_Hs01_00093224 predicted 1297
8 SASI_Hs01_00093225 predicted 1116
9 SASI_Hs01_00093226 predicted 1551
10 SASI_Hs01_00093227 predicted 1381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140447 predicted 2716
2 SASI_Hs01_00140448 predicted 2772
3 SASI_Hs01_00140449 predicted 2811
4 SASI_Hs01_00140450 predicted 2901
5 SASI_Hs01_00140451 predicted 3370
6 SASI_Hs01_00140452 predicted 3108
7 SASI_Hs01_00140453 predicted 3066
8 SASI_Hs01_00140454 predicted 3151
9 SASI_Hs02_00362267 predicted 2810
10 SASI_Hs01_00140456 predicted 3364
11 SASI_Hs01_00140455 predicted 2681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016097 predicted 818
2 SASI_Hs01_00016098 predicted 871
3 SASI_Hs01_00016099 predicted 918
4 SASI_Hs01_00016100 predicted 1005
5 SASI_Hs01_00016101 predicted 1476
6 SASI_Hs01_00016102 predicted 1212
7 SASI_Hs01_00016103 predicted 1165
8 SASI_Hs01_00016104 predicted 1255
9 SASI_Hs02_00362268 predicted 915
10 SASI_Hs01_00016106 predicted 1458
11 SASI_Hs01_00016105 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378967 predicted 500
2 SASI_Hs02_00378968 predicted 596
3 SASI_Hs02_00378969 predicted 643
4 SASI_Hs02_00378970 predicted 1247
5 SASI_Hs02_00378971 predicted 1092
6 SASI_Hs02_00378972 predicted 1023
7 SASI_Hs02_00378973 predicted 635
8 SASI_Hs02_00378974 predicted 462
9 SASI_Hs02_00378975 predicted 634
10 SASI_Hs02_00378976 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202731 predicted 1768
2 SASI_Rn02_00202732 predicted 1460
3 SASI_Rn02_00202733 predicted 1791
4 SASI_Rn02_00202734 predicted 1907
5 SASI_Rn02_00202735 predicted 1640
6 SASI_Rn02_00202736 predicted 1054
7 SASI_Rn01_00048989 predicted 1338
8 SASI_Rn02_00202737 predicted 1802
9 SASI_Rn01_00048990 predicted 1758
10 SASI_Rn02_00202738 predicted 1429
11 SASI_Rn01_00048984 predicted 1168
12 SASI_Rn01_00048985 predicted 481
13 SASI_Rn01_00048986 predicted 212
14 SASI_Rn01_00048987 predicted 874
15 SASI_Rn01_00048988 predicted 2435
16 SASI_Rn01_00048991 predicted 2256
17 SASI_Rn01_00048992 predicted 651
18 SASI_Rn01_00048993 predicted 2195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111221 predicted 549
2 SASI_Rn01_00111222 predicted 1208
3 SASI_Rn02_00261875 predicted 593
4 SASI_Rn01_00111224 predicted 1241
5 SASI_Rn01_00111225 predicted 1314
6 SASI_Rn01_00111226 predicted 1340
7 SASI_Rn01_00111227 predicted 1286
8 SASI_Rn01_00111228 predicted 537
9 SASI_Rn02_00261876 predicted 707
10 SASI_Rn01_00111230 predicted 991
11 SASI_Rn01_00111223 predicted 1191
12 SASI_Rn01_00111229 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262855 predicted 2430
2 SASI_Rn02_00262856 predicted 2458
3 SASI_Rn02_00262857 predicted 1580
4 SASI_Rn01_00030808 predicted 2535
5 SASI_Rn01_00030810 predicted 2559
6 SASI_Rn01_00030811 predicted 1330
7 SASI_Rn01_00030812 predicted 2506
8 SASI_Rn02_00262858 predicted 1764
9 SASI_Rn02_00262859 predicted 1399
10 SASI_Rn02_00262860 predicted 1335
11 SASI_Rn01_00030803 predicted 1166
12 SASI_Rn01_00030804 predicted 3266
13 SASI_Rn01_00030805 predicted 477
14 SASI_Rn01_00030806 predicted 220
15 SASI_Rn01_00030807 predicted 873
16 SASI_Rn01_00030809 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292712 predicted 304
2 SASI_Mm02_00292713 predicted 880
3 SASI_Mm02_00292714 predicted 492
4 SASI_Mm02_00292715 predicted 2101
5 SASI_Mm02_00292716 predicted 401
6 SASI_Mm02_00292717 predicted 867
7 SASI_Mm02_00292718 predicted 1972
8 SASI_Mm02_00292719 predicted 477
9 SASI_Mm02_00292720 predicted 391
10 SASI_Mm02_00292721 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292742 predicted 664
2 SASI_Mm02_00292743 predicted 856
3 SASI_Mm02_00292744 predicted 861
4 SASI_Mm02_00292745 predicted 759
5 SASI_Mm02_00292746 predicted 1062
6 SASI_Mm02_00292747 predicted 1291
7 SASI_Mm02_00292748 predicted 644
8 SASI_Mm02_00292749 predicted 1267
9 SASI_Mm02_00292750 predicted 653
10 SASI_Mm02_00292751 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318289 predicted 309
2 SASI_Mm01_00034787 predicted 876
3 SASI_Mm02_00318290 predicted 489
4 SASI_Mm02_00318291 predicted 2101
5 SASI_Mm02_00318292 predicted 399
6 SASI_Mm02_00318293 predicted 864
7 SASI_Mm02_00318294 predicted 1981
8 SASI_Mm01_00034791 predicted 475
9 SASI_Mm02_00318295 predicted 392
10 SASI_Mm02_00318296 predicted 661
11 SASI_Mm01_00034785 predicted 2490
12 SASI_Mm01_00034786 predicted 3226
13 SASI_Mm01_00034788 predicted 2241
14 SASI_Mm01_00034789 predicted 2581
15 SASI_Mm01_00034790 predicted 2165
16 SASI_Mm01_00034792 predicted 2717
17 SASI_Mm01_00034793 predicted 2624
18 SASI_Mm01_00034794 predicted 3119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051694 predicted 1297
2 SASI_Mm01_00051695 predicted 1191
3 SASI_Mm01_00051696 predicted 1954
4 SASI_Mm01_00051697 predicted 1429
5 SASI_Mm01_00051698 predicted 1932
6 SASI_Mm01_00051699 predicted 2058
7 SASI_Mm01_00051700 predicted 2034
8 SASI_Mm01_00051701 predicted 1292
9 SASI_Mm01_00051702 predicted 1423
10 SASI_Mm01_00051703 predicted 1322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324774 predicted 287
2 SASI_Mm02_00324775 predicted 291
3 SASI_Mm02_00324776 predicted 328
4 SASI_Mm02_00324777 predicted 280
5 SASI_Mm02_00324778 predicted 307
6 SASI_Mm02_00324779 predicted 287
7 SASI_Mm01_00074341 predicted 291
8 SASI_Mm02_00324780 predicted 947
9 SASI_Mm02_00324781 predicted 284
10 SASI_Mm02_00324782 predicted 286
11 SASI_Mm01_00074340 predicted 1028
12 SASI_Mm01_00074342 predicted 594
13 SASI_Mm01_00074343 predicted 321
14 SASI_Mm01_00074344 predicted 264
15 SASI_Mm01_00074345 predicted 586
16 SASI_Mm01_00074346 predicted 513
17 SASI_Mm01_00074347 predicted 497
18 SASI_Mm01_00074348 predicted 758
19 SASI_Mm01_00074349 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326467 predicted 1427
2 SASI_Mm02_00326468 predicted 1399
3 SASI_Mm02_00326469 predicted 1414
4 SASI_Mm02_00326470 predicted 1446
5 SASI_Mm02_00326471 predicted 1294
6 SASI_Mm02_00326472 predicted 1157
7 SASI_Mm02_00326473 predicted 1020
8 SASI_Mm02_00326474 predicted 1095
9 SASI_Mm02_00326475 predicted 293
10 SASI_Mm02_00326476 predicted 1287
11 SASI_Mm01_00084145 predicted 878
12 SASI_Mm01_00084146 predicted 830
13 SASI_Mm01_00084147 predicted 725
14 SASI_Mm01_00084148 predicted 727
15 SASI_Mm01_00084149 predicted 730
16 SASI_Mm01_00084150 predicted 833
17 SASI_Mm01_00084151 predicted 664
18 SASI_Mm01_00084152 predicted 731
19 SASI_Mm01_00084153 predicted 697
20 SASI_Mm01_00084154 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351644 predicted 717
2 SASI_Mm02_00351645 predicted 898
3 SASI_Mm02_00351646 predicted 913
4 SASI_Mm02_00351647 predicted 799
5 SASI_Mm02_00351648 predicted 1112
6 SASI_Mm02_00351649 predicted 1342
7 SASI_Mm02_00351650 predicted 687
8 SASI_Mm02_00351651 predicted 1309
9 SASI_Mm02_00351652 predicted 698
10 SASI_Mm02_00351653 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351654 predicted 303
2 SASI_Mm02_00351655 predicted 882
3 SASI_Mm02_00351656 predicted 490
4 SASI_Mm02_00351657 predicted 2097
5 SASI_Mm02_00351658 predicted 404
6 SASI_Mm02_00351659 predicted 865
7 SASI_Mm02_00351660 predicted 1979
8 SASI_Mm02_00351661 predicted 476
9 SASI_Mm02_00351662 predicted 388
10 SASI_Mm02_00351663 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351664 predicted 306
2 SASI_Mm02_00351665 predicted 876
3 SASI_Mm02_00351666 predicted 493
4 SASI_Mm02_00351667 predicted 2103
5 SASI_Mm02_00351668 predicted 404
6 SASI_Mm02_00351669 predicted 863
7 SASI_Mm02_00351670 predicted 1977
8 SASI_Mm02_00351671 predicted 476
9 SASI_Mm02_00351672 predicted 391
10 SASI_Mm02_00351673 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353204 predicted 282
2 SASI_Mm02_00353205 predicted 942
3 SASI_Mm02_00353206 predicted 417
4 SASI_Mm02_00353207 predicted 917
5 SASI_Mm02_00353208 predicted 1046
6 SASI_Mm02_00353209 predicted 1010
7 SASI_Mm02_00353210 predicted 274
8 SASI_Mm02_00353211 predicted 407
9 SASI_Mm02_00353212 predicted 433
10 SASI_Mm02_00353213 predicted 308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000516
VALIDATED
GNAS MISSION shRNA Bacterial Glycerol Stock
GNAS complex locus
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000516.4-1564s21c1
Sequence:CCGGTAAAGCCTTAAGCACAATTAACTCGAGTTAATTGTGCTTAAGGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000516.4-1070s21c1
Sequence:CCGGCAACGATGTGACTGCCATCATCTCGAGATGATGGCAGTCACATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000516.4-1424s21c1
Sequence:CCGGTCACTACTGCTACCCTCATTTCTCGAGAAATGAGGGTAGCAGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000516.4-1294s21c1
Sequence:CCGGCAGAATTTGCTCGCTACACTACTCGAGTAGTGTAGCGAGCAAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000516.4-1365s21c1
Sequence:CCGGGCCAAGTACTTCATTCGAGATCTCGAGATCTCGAATGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000516.4-1620s21c1
Sequence:CCGGACCCACCATAGGGCATGATTACTCGAGTAATCATGCCCTATGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000516.3-1388s1c1
Sequence:CCGGGCTTGCTTAGATGTTCCAAATCTCGAGATTTGGAACATCTAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000516.3-1056s1c1
Sequence:CCGGGCCAAGTACTTCATTCGAGATCTCGAGATCTCGAATGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000516.3-985s1c1
Sequence:CCGGCAGAATTTGCTCGCTACACTACTCGAGTAGTGTAGCGAGCAAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000516.3-761s1c1
Sequence:CCGGCAACGATGTGACTGCCATCATCTCGAGATGATGGCAGTCACATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000516.3-474s1c1
Sequence:CCGGCCTCCCGAATTCTATGAGCATCTCGAGATGCTCATAGAATTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000516
VALIDATED
GNAS MISSION shRNA shRNA Plasmid DNA
GNAS complex locus
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000516.4-1564s21c1
Sequence:CCGGTAAAGCCTTAAGCACAATTAACTCGAGTTAATTGTGCTTAAGGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000516.4-1070s21c1
Sequence:CCGGCAACGATGTGACTGCCATCATCTCGAGATGATGGCAGTCACATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000516.4-1424s21c1
Sequence:CCGGTCACTACTGCTACCCTCATTTCTCGAGAAATGAGGGTAGCAGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000516.4-1294s21c1
Sequence:CCGGCAGAATTTGCTCGCTACACTACTCGAGTAGTGTAGCGAGCAAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000516.4-1365s21c1
Sequence:CCGGGCCAAGTACTTCATTCGAGATCTCGAGATCTCGAATGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000516.4-1620s21c1
Sequence:CCGGACCCACCATAGGGCATGATTACTCGAGTAATCATGCCCTATGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000516.3-1388s1c1
Sequence:CCGGGCTTGCTTAGATGTTCCAAATCTCGAGATTTGGAACATCTAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000516.3-1056s1c1
Sequence:CCGGGCCAAGTACTTCATTCGAGATCTCGAGATCTCGAATGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000516.3-985s1c1
Sequence:CCGGCAGAATTTGCTCGCTACACTACTCGAGTAGTGTAGCGAGCAAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000516.3-761s1c1
Sequence:CCGGCAACGATGTGACTGCCATCATCTCGAGATGATGGCAGTCACATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000516.3-474s1c1
Sequence:CCGGCCTCCCGAATTCTATGAGCATCTCGAGATGCTCATAGAATTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000516
VALIDATED
GNAS MISSION shRNA Lentiviral Transduction Particles
GNAS complex locus
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000516.4-1564s21c1
Sequence:CCGGTAAAGCCTTAAGCACAATTAACTCGAGTTAATTGTGCTTAAGGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000516.4-1070s21c1
Sequence:CCGGCAACGATGTGACTGCCATCATCTCGAGATGATGGCAGTCACATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000516.4-1424s21c1
Sequence:CCGGTCACTACTGCTACCCTCATTTCTCGAGAAATGAGGGTAGCAGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000516.4-1294s21c1
Sequence:CCGGCAGAATTTGCTCGCTACACTACTCGAGTAGTGTAGCGAGCAAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000516.4-1365s21c1
Sequence:CCGGGCCAAGTACTTCATTCGAGATCTCGAGATCTCGAATGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000516.4-1620s21c1
Sequence:CCGGACCCACCATAGGGCATGATTACTCGAGTAATCATGCCCTATGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000516.3-1388s1c1
Sequence:CCGGGCTTGCTTAGATGTTCCAAATCTCGAGATTTGGAACATCTAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000516.3-1056s1c1
Sequence:CCGGGCCAAGTACTTCATTCGAGATCTCGAGATCTCGAATGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000516.3-985s1c1
Sequence:CCGGCAGAATTTGCTCGCTACACTACTCGAGTAGTGTAGCGAGCAAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000516.3-761s1c1
Sequence:CCGGCAACGATGTGACTGCCATCATCTCGAGATGATGGCAGTCACATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000516.3-474s1c1
Sequence:CCGGCCTCCCGAATTCTATGAGCATCTCGAGATGCTCATAGAATTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010309
VALIDATED
GNAS MISSION shRNA Bacterial Glycerol Stock
GNAS complex locus
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010309.3-3229s21c1
Sequence:CCGGGCCAAGTACTTCATTCGGGATCTCGAGATCCCGAATGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010309.3-3243s21c1
Sequence:CCGGTCGGGATGAGTTTCTGAGAATCTCGAGATTCTCAGAAACTCATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010309.3-667s21c1
Sequence:CCGGCCTGAAGAATCTGTGCCATTTCTCGAGAAATGGCACAGATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010309.3-2406s21c1
Sequence:CCGGCCTGCATGTTAATGGGTTTAACTCGAGTTAAACCCATTAACATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010309.2-2406s1c1
Sequence:CCGGCCTGCATGTTAATGGGTTTAACTCGAGTTAAACCCATTAACATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010309.2-667s1c1
Sequence:CCGGCCTGAAGAATCTGTGCCATTTCTCGAGAAATGGCACAGATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010309.2-3243s1c1
Sequence:CCGGTCGGGATGAGTTTCTGAGAATCTCGAGATTCTCAGAAACTCATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010309.2-3229s1c1
Sequence:CCGGGCCAAGTACTTCATTCGGGATCTCGAGATCCCGAATGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010309.2-2271s1c1
Sequence:CCGGCGCAGATAAGAAACGCAGCAACTCGAGTTGCTGCGTTTCTTATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010309
VALIDATED
GNAS MISSION shRNA shRNA Plasmid DNA
GNAS complex locus
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010309.3-3229s21c1
Sequence:CCGGGCCAAGTACTTCATTCGGGATCTCGAGATCCCGAATGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010309.3-3243s21c1
Sequence:CCGGTCGGGATGAGTTTCTGAGAATCTCGAGATTCTCAGAAACTCATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010309.3-667s21c1
Sequence:CCGGCCTGAAGAATCTGTGCCATTTCTCGAGAAATGGCACAGATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010309.3-2406s21c1
Sequence:CCGGCCTGCATGTTAATGGGTTTAACTCGAGTTAAACCCATTAACATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010309.2-2406s1c1
Sequence:CCGGCCTGCATGTTAATGGGTTTAACTCGAGTTAAACCCATTAACATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010309.2-667s1c1
Sequence:CCGGCCTGAAGAATCTGTGCCATTTCTCGAGAAATGGCACAGATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010309.2-3243s1c1
Sequence:CCGGTCGGGATGAGTTTCTGAGAATCTCGAGATTCTCAGAAACTCATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010309.2-3229s1c1
Sequence:CCGGGCCAAGTACTTCATTCGGGATCTCGAGATCCCGAATGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010309.2-2271s1c1
Sequence:CCGGCGCAGATAAGAAACGCAGCAACTCGAGTTGCTGCGTTTCTTATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010309
VALIDATED
GNAS MISSION shRNA Lentiviral Transduction Particles
GNAS complex locus
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010309.3-3229s21c1
Sequence:CCGGGCCAAGTACTTCATTCGGGATCTCGAGATCCCGAATGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010309.3-3243s21c1
Sequence:CCGGTCGGGATGAGTTTCTGAGAATCTCGAGATTCTCAGAAACTCATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010309.3-667s21c1
Sequence:CCGGCCTGAAGAATCTGTGCCATTTCTCGAGAAATGGCACAGATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010309.3-2406s21c1
Sequence:CCGGCCTGCATGTTAATGGGTTTAACTCGAGTTAAACCCATTAACATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010309.2-2406s1c1
Sequence:CCGGCCTGCATGTTAATGGGTTTAACTCGAGTTAAACCCATTAACATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010309.2-667s1c1
Sequence:CCGGCCTGAAGAATCTGTGCCATTTCTCGAGAAATGGCACAGATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010309.2-3243s1c1
Sequence:CCGGTCGGGATGAGTTTCTGAGAATCTCGAGATTCTCAGAAACTCATCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010309.2-3229s1c1
Sequence:CCGGGCCAAGTACTTCATTCGGGATCTCGAGATCCCGAATGAAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010309.2-2271s1c1
Sequence:CCGGCGCAGATAAGAAACGCAGCAACTCGAGTTGCTGCGTTTCTTATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks