EMAIL THIS PAGE TO A FRIEND

GNAT1

guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1

69 Gene Product Result for
Synonyms: CSNBAD3 GBT1 GNATR
UniProtKB ID: P11488, Q4VBN2
Gene ID:
Human(2779) Summary: Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in rods. This gene is also expressed in other cells, and has been implicated in bitter taste transduction in rat taste cells. Mutations in this gene result in autosomal dominant congenital stationary night blindness. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Feb 2009]
Mouse(14685) guanine nucleotide binding protein, alpha transducing 1
Rat(363143) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1
Zebrafish(140428) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1
dog(403613) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1
chicken(395426) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1
cow(281794) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1
domestic cat(101091927) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1
domestic guinea pig(100307114) guanine nucleotide binding protein, alpha transducing 1
naked mole-rat(101696407) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1
sheep(101121976) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000172 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000172 Rosetta Predictions human pricing
NM_144499 Rosetta Predictions human pricing
NM_001108780 Rosetta Predictions rat pricing
NM_008140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051068 predicted 198
2 SASI_Hs01_00051069 predicted 632
3 SASI_Hs01_00051070 predicted 305
4 SASI_Hs02_00302006 predicted 915
5 SASI_Hs01_00051072 predicted 286
6 SASI_Hs01_00051073 predicted 290
7 SASI_Hs01_00051074 predicted 354
8 SASI_Hs01_00051075 predicted 461
9 SASI_Hs01_00051076 predicted 854
10 SASI_Hs01_00051077 predicted 452
11 SASI_Hs01_00051071 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051538 predicted 200
2 SASI_Hs01_00051539 predicted 630
3 SASI_Hs01_00051540 predicted 307
4 SASI_Hs02_00364323 predicted 913
5 SASI_Hs01_00051542 predicted 291
6 SASI_Hs01_00051543 predicted 288
7 SASI_Hs01_00051544 predicted 355
8 SASI_Hs01_00051545 predicted 457
9 SASI_Hs01_00051546 predicted 857
10 SASI_Hs01_00051547 predicted 448
11 SASI_Hs01_00051541 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242005 predicted 594
2 SASI_Rn02_00242006 predicted 901
3 SASI_Rn02_00242007 predicted 594
4 SASI_Rn02_00242008 predicted 940
5 SASI_Rn02_00242009 predicted 467
6 SASI_Rn02_00242010 predicted 300
7 SASI_Rn02_00242011 predicted 979
8 SASI_Rn02_00242012 predicted 590
9 SASI_Rn02_00242013 predicted 990
10 SASI_Rn02_00242014 predicted 1105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119025 predicted 926
2 SASI_Mm01_00119026 predicted 481
3 SASI_Mm01_00119027 predicted 812
4 SASI_Mm01_00119028 predicted 457
5 SASI_Mm01_00119029 predicted 575
6 SASI_Mm01_00119030 predicted 1100
7 SASI_Mm01_00119031 predicted 965
8 SASI_Mm01_00119032 predicted 981
9 SASI_Mm01_00119033 predicted 801
10 SASI_Mm01_00119034 predicted 470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008140
GNAT1 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-587s1c1
Sequence:CCGGCGAGACTCAATTCTCCTTCAACTCGAGTTGAAGGAGAATTGAGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-230s1c1
Sequence:CCGGCCTCGAGTTCATTGCCATCATCTCGAGATGATGGCAATGAACTCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-1020s1c1
Sequence:CCGGCAGAACGTCAAGTTTGTCTTTCTCGAGAAAGACAAACTTGACGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-957s1c1
Sequence:CCGGGAGCTTAACATGCGACGTGATCTCGAGATCACGTCGCATGTTAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-812s1c1
Sequence:CCGGCACAACGTCTATCGTGCTCTTCTCGAGAAGAGCACGATAGACGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008140
GNAT1 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-587s1c1
Sequence:CCGGCGAGACTCAATTCTCCTTCAACTCGAGTTGAAGGAGAATTGAGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-230s1c1
Sequence:CCGGCCTCGAGTTCATTGCCATCATCTCGAGATGATGGCAATGAACTCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-1020s1c1
Sequence:CCGGCAGAACGTCAAGTTTGTCTTTCTCGAGAAAGACAAACTTGACGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-957s1c1
Sequence:CCGGGAGCTTAACATGCGACGTGATCTCGAGATCACGTCGCATGTTAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-812s1c1
Sequence:CCGGCACAACGTCTATCGTGCTCTTCTCGAGAAGAGCACGATAGACGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008140
GNAT1 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-587s1c1
Sequence:CCGGCGAGACTCAATTCTCCTTCAACTCGAGTTGAAGGAGAATTGAGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-230s1c1
Sequence:CCGGCCTCGAGTTCATTGCCATCATCTCGAGATGATGGCAATGAACTCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-1020s1c1
Sequence:CCGGCAGAACGTCAAGTTTGTCTTTCTCGAGAAAGACAAACTTGACGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-957s1c1
Sequence:CCGGGAGCTTAACATGCGACGTGATCTCGAGATCACGTCGCATGTTAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008140.2-812s1c1
Sequence:CCGGCACAACGTCTATCGTGCTCTTCTCGAGAAGAGCACGATAGACGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000172
GNAT1 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-302s1c1
Sequence:CCGGCCTCGAGTTTATCGCCATCATCTCGAGATGATGGCGATAAACTCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-1085s1c1
Sequence:CCGGCGACACGCAGAACGTCAAATTCTCGAGAATTTGACGTTCTGCGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-755s1c1
Sequence:CCGGCGTGACCTGCATCATCTTCATCTCGAGATGAAGATGATGCAGGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-1124s1c1
Sequence:CCGGCGACATCATCATCAAGGAGAACTCGAGTTCTCCTTGATGATGATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-920s1c1
Sequence:CCGGCGTCTTCTTCGAGAAGATCAACTCGAGTTGATCTTCTCGAAGAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000172.3-652s21c1
Sequence:CCGGGCATCATCGAGACGCAGTTCTCTCGAGAGAACTGCGTCTCGATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000172.3-1044s21c1
Sequence:CCGGCGCGACGTGAAGGAGATCTATCTCGAGATAGATCTCCTTCACGTCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000172
GNAT1 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-302s1c1
Sequence:CCGGCCTCGAGTTTATCGCCATCATCTCGAGATGATGGCGATAAACTCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-1085s1c1
Sequence:CCGGCGACACGCAGAACGTCAAATTCTCGAGAATTTGACGTTCTGCGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-755s1c1
Sequence:CCGGCGTGACCTGCATCATCTTCATCTCGAGATGAAGATGATGCAGGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-1124s1c1
Sequence:CCGGCGACATCATCATCAAGGAGAACTCGAGTTCTCCTTGATGATGATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-920s1c1
Sequence:CCGGCGTCTTCTTCGAGAAGATCAACTCGAGTTGATCTTCTCGAAGAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000172.3-652s21c1
Sequence:CCGGGCATCATCGAGACGCAGTTCTCTCGAGAGAACTGCGTCTCGATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000172.3-1044s21c1
Sequence:CCGGCGCGACGTGAAGGAGATCTATCTCGAGATAGATCTCCTTCACGTCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000172
GNAT1 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-302s1c1
Sequence:CCGGCCTCGAGTTTATCGCCATCATCTCGAGATGATGGCGATAAACTCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-1085s1c1
Sequence:CCGGCGACACGCAGAACGTCAAATTCTCGAGAATTTGACGTTCTGCGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-755s1c1
Sequence:CCGGCGTGACCTGCATCATCTTCATCTCGAGATGAAGATGATGCAGGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-1124s1c1
Sequence:CCGGCGACATCATCATCAAGGAGAACTCGAGTTCTCCTTGATGATGATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000172.2-920s1c1
Sequence:CCGGCGTCTTCTTCGAGAAGATCAACTCGAGTTGATCTTCTCGAAGAAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000172.3-652s21c1
Sequence:CCGGGCATCATCGAGACGCAGTTCTCTCGAGAGAACTGCGTCTCGATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000172.3-1044s21c1
Sequence:CCGGCGCGACGTGAAGGAGATCTATCTCGAGATAGATCTCCTTCACGTCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)