EMAIL THIS PAGE TO A FRIEND

GNAT2

guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2

51 Gene Product Result for
Synonyms: ACHM4 GNATC
UniProtKB ID: P19087
Gene ID:
Human(2780) Summary: Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in cones. [provided by RefSeq, Jul 2008]
Mouse(14686) guanine nucleotide binding protein, alpha transducing 2
Rat(365901) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
sheep(100233166) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
domestic guinea pig(100731154) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
naked mole-rat(101703621) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
Zebrafish(140429) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
cow(281795) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
domestic cat(101100579) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
dog(490119) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
chicken(395425) guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005272 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005272 Rosetta Predictions human pricing
NM_001108950 Rosetta Predictions rat pricing
NM_008141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066737 predicted 678
2 SASI_Hs01_00066738 predicted 639
3 SASI_Hs01_00066740 predicted 698
4 SASI_Hs01_00066741 predicted 689
5 SASI_Hs01_00066742 predicted 789
6 SASI_Hs02_00339316 predicted 993
7 SASI_Hs01_00066743 predicted 645
8 SASI_Hs01_00066745 predicted 967
9 SASI_Hs02_00339317 predicted 952
10 SASI_Hs02_00339318 predicted 661
11 SASI_Hs01_00066739 predicted 1225
12 SASI_Hs01_00066744 predicted 1199
13 SASI_Hs01_00066746 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243684 predicted 314
2 SASI_Rn02_00243685 predicted 217
3 SASI_Rn02_00243686 predicted 321
4 SASI_Rn02_00243687 predicted 135
5 SASI_Rn02_00243688 predicted 290
6 SASI_Rn02_00243689 predicted 265
7 SASI_Rn02_00243690 predicted 138
8 SASI_Rn02_00243691 predicted 138
9 SASI_Rn02_00243692 predicted 305
10 SASI_Rn02_00243693 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313226 predicted 1091
2 SASI_Mm01_00160648 predicted 483
3 SASI_Mm01_00160650 predicted 1087
4 SASI_Mm01_00160651 predicted 507
5 SASI_Mm02_00313227 predicted 641
6 SASI_Mm01_00160653 predicted 1180
7 SASI_Mm01_00160654 predicted 613
8 SASI_Mm01_00160655 predicted 600
9 SASI_Mm01_00160656 predicted 559
10 SASI_Mm01_00160657 predicted 522
11 SASI_Mm01_00160649 predicted 969
12 SASI_Mm01_00160652 predicted 970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005272
GNAT2 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-1193s21c1
Sequence:CCGGCAGATACACAGAATGTCAAATCTCGAGATTTGACATTCTGTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-860s21c1
Sequence:CCGGAGGGAGTCACCTGCATCATTTCTCGAGAAATGATGCAGGTGACTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-378s21c1
Sequence:CCGGCATTCACCAGGATGGCTATTCCTCGAGGAATAGCCATCCTGGTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-279s21c1
Sequence:CCGGGCTGCAGGAGGATGCTGATAACTCGAGTTATCAGCATCCTCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-1050s21c1
Sequence:CCGGGAAAGTCCATCTCAGCATTTGCTCGAGCAAATGCTGAGATGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005272.2-1290s1c1
Sequence:CCGGCCTCAGGTATAAGTTCTATAACTCGAGTTATAGAACTTATACCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005272.2-667s1c1
Sequence:CCGGGCATCTTACTACCTGAACCAACTCGAGTTGGTTCAGGTAGTAAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005272.2-488s1c1
Sequence:CCGGGCATCGATTATGCTGAACCAACTCGAGTTGGTTCAGCATAATCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005272.2-1134s1c1
Sequence:CCGGCCTTGACCTCAATATGCGAAACTCGAGTTTCGCATATTGAGGTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005272
GNAT2 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-1193s21c1
Sequence:CCGGCAGATACACAGAATGTCAAATCTCGAGATTTGACATTCTGTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-860s21c1
Sequence:CCGGAGGGAGTCACCTGCATCATTTCTCGAGAAATGATGCAGGTGACTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-378s21c1
Sequence:CCGGCATTCACCAGGATGGCTATTCCTCGAGGAATAGCCATCCTGGTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-279s21c1
Sequence:CCGGGCTGCAGGAGGATGCTGATAACTCGAGTTATCAGCATCCTCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-1050s21c1
Sequence:CCGGGAAAGTCCATCTCAGCATTTGCTCGAGCAAATGCTGAGATGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005272.2-1290s1c1
Sequence:CCGGCCTCAGGTATAAGTTCTATAACTCGAGTTATAGAACTTATACCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005272.2-667s1c1
Sequence:CCGGGCATCTTACTACCTGAACCAACTCGAGTTGGTTCAGGTAGTAAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005272.2-488s1c1
Sequence:CCGGGCATCGATTATGCTGAACCAACTCGAGTTGGTTCAGCATAATCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005272.2-1134s1c1
Sequence:CCGGCCTTGACCTCAATATGCGAAACTCGAGTTTCGCATATTGAGGTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005272
GNAT2 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-1193s21c1
Sequence:CCGGCAGATACACAGAATGTCAAATCTCGAGATTTGACATTCTGTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-860s21c1
Sequence:CCGGAGGGAGTCACCTGCATCATTTCTCGAGAAATGATGCAGGTGACTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-378s21c1
Sequence:CCGGCATTCACCAGGATGGCTATTCCTCGAGGAATAGCCATCCTGGTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-279s21c1
Sequence:CCGGGCTGCAGGAGGATGCTGATAACTCGAGTTATCAGCATCCTCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005272.3-1050s21c1
Sequence:CCGGGAAAGTCCATCTCAGCATTTGCTCGAGCAAATGCTGAGATGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005272.2-1290s1c1
Sequence:CCGGCCTCAGGTATAAGTTCTATAACTCGAGTTATAGAACTTATACCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005272.2-667s1c1
Sequence:CCGGGCATCTTACTACCTGAACCAACTCGAGTTGGTTCAGGTAGTAAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005272.2-488s1c1
Sequence:CCGGGCATCGATTATGCTGAACCAACTCGAGTTGGTTCAGCATAATCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005272.2-1134s1c1
Sequence:CCGGCCTTGACCTCAATATGCGAAACTCGAGTTTCGCATATTGAGGTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008141
VALIDATED
GNAT2 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008141.2-347s21c1
Sequence:CCGGCCACACTAGGCATTGACTATGCTCGAGCATAGTCAATGCCTAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008141.2-1146s21c1
Sequence:CCGGATGCTCAGTTCCTCGAATATACTCGAGTATATTCGAGGAACTGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008141.2-976s21c1
Sequence:CCGGGCCGGGAATTATATCAAGAGTCTCGAGACTCTTGATATAATTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008141.2-1181s21c1
Sequence:CCGGGCTTAGAATCTGAGGCTTCATCTCGAGATGAAGCCTCAGATTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008141.2-531s21c1
Sequence:CCGGCTCGGCATCTTACTACCTGAACTCGAGTTCAGGTAGTAAGATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008141.2-1181s1c1
Sequence:CCGGGCTTAGAATCTGAGGCTTCATCTCGAGATGAAGCCTCAGATTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008141.2-976s1c1
Sequence:CCGGGCCGGGAATTATATCAAGAGTCTCGAGACTCTTGATATAATTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008141.2-570s1c1
Sequence:CCGGAGACCCTAACTACCTCCCTAACTCGAGTTAGGGAGGTAGTTAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008141.2-531s1c1
Sequence:CCGGCTCGGCATCTTACTACCTGAACTCGAGTTCAGGTAGTAAGATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008141.2-810s1c1
Sequence:CCGGGCACGAGTCTTTGCATCTGTTCTCGAGAACAGATGCAAAGACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008141
VALIDATED
GNAT2 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008141.2-347s21c1
Sequence:CCGGCCACACTAGGCATTGACTATGCTCGAGCATAGTCAATGCCTAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008141.2-1146s21c1
Sequence:CCGGATGCTCAGTTCCTCGAATATACTCGAGTATATTCGAGGAACTGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008141.2-976s21c1
Sequence:CCGGGCCGGGAATTATATCAAGAGTCTCGAGACTCTTGATATAATTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008141.2-1181s21c1
Sequence:CCGGGCTTAGAATCTGAGGCTTCATCTCGAGATGAAGCCTCAGATTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008141.2-531s21c1
Sequence:CCGGCTCGGCATCTTACTACCTGAACTCGAGTTCAGGTAGTAAGATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008141.2-1181s1c1
Sequence:CCGGGCTTAGAATCTGAGGCTTCATCTCGAGATGAAGCCTCAGATTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008141.2-976s1c1
Sequence:CCGGGCCGGGAATTATATCAAGAGTCTCGAGACTCTTGATATAATTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008141.2-570s1c1
Sequence:CCGGAGACCCTAACTACCTCCCTAACTCGAGTTAGGGAGGTAGTTAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008141.2-531s1c1
Sequence:CCGGCTCGGCATCTTACTACCTGAACTCGAGTTCAGGTAGTAAGATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008141.2-810s1c1
Sequence:CCGGGCACGAGTCTTTGCATCTGTTCTCGAGAACAGATGCAAAGACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008141
VALIDATED
GNAT2 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008141.2-347s21c1
Sequence:CCGGCCACACTAGGCATTGACTATGCTCGAGCATAGTCAATGCCTAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008141.2-1146s21c1
Sequence:CCGGATGCTCAGTTCCTCGAATATACTCGAGTATATTCGAGGAACTGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008141.2-976s21c1
Sequence:CCGGGCCGGGAATTATATCAAGAGTCTCGAGACTCTTGATATAATTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008141.2-1181s21c1
Sequence:CCGGGCTTAGAATCTGAGGCTTCATCTCGAGATGAAGCCTCAGATTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008141.2-531s21c1
Sequence:CCGGCTCGGCATCTTACTACCTGAACTCGAGTTCAGGTAGTAAGATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008141.2-1181s1c1
Sequence:CCGGGCTTAGAATCTGAGGCTTCATCTCGAGATGAAGCCTCAGATTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008141.2-976s1c1
Sequence:CCGGGCCGGGAATTATATCAAGAGTCTCGAGACTCTTGATATAATTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008141.2-570s1c1
Sequence:CCGGAGACCCTAACTACCTCCCTAACTCGAGTTAGGGAGGTAGTTAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008141.2-531s1c1
Sequence:CCGGCTCGGCATCTTACTACCTGAACTCGAGTTCAGGTAGTAAGATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008141.2-810s1c1
Sequence:CCGGGCACGAGTCTTTGCATCTGTTCTCGAGAACAGATGCAAAGACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks