EMAIL THIS PAGE TO A FRIEND

GNAT3

guanine nucleotide binding protein, alpha transducing 3

62 Gene Product Result for
Synonyms: GDCA
UniProtKB ID: A8MTJ3, A4D1B2, A4D1B3, B9EJG5
Gene ID:
Mouse(242851) guanine nucleotide binding protein, alpha transducing 3
Rat(286924) guanine nucleotide binding protein, alpha transducing 3
chicken(427851) guanine nucleotide binding protein, alpha transducing 3
domestic cat(101093591) guanine nucleotide binding protein, alpha transducing 3
cow(516262) guanine nucleotide binding protein, alpha transducing 3
dog(491406) guanine nucleotide binding protein, alpha transducing 3
domestic guinea pig(100729909) guanine nucleotide binding protein, alpha transducing 3
naked mole-rat(101703534) guanine nucleotide binding protein, alpha transducing 3
sheep(101115534) guanine nucleotide binding protein, alpha transducing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301083 ANTI-GNAT3 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB2501807 Anti-GNAT3 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, canine, human, rat
ELISA, immunohistochemistry pricing
SAB4300846 Anti-GNAT3 antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102386 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081143 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081143 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081143 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224361 MISSION® esiRNA esiRNA targeting human GNAT3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102386 Rosetta Predictions human pricing
XM_294370 Rosetta Predictions human pricing
NM_173139 Rosetta Predictions rat pricing
NM_001081143 Rosetta Predictions mouse pricing
XM_144196 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323033 predicted 543
2 SASI_Hs02_00323034 predicted 548
3 SASI_Hs02_00323035 predicted 451
4 SASI_Hs02_00323036 predicted 333
5 SASI_Hs02_00323037 predicted 408
6 SASI_Hs02_00323038 predicted 749
7 SASI_Hs02_00323039 predicted 461
8 SASI_Hs02_00323040 predicted 241
9 SASI_Hs02_00323041 predicted 669
10 SASI_Hs02_00323042 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_294370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291036 predicted 663
2 SASI_Hs01_00291037 predicted 712
3 SASI_Hs01_00291038 predicted 708
4 SASI_Hs01_00291039 predicted 652
5 SASI_Hs01_00291040 predicted 704
6 SASI_Hs01_00291041 predicted 658
7 SASI_Hs01_00291042 predicted 706
8 SASI_Hs01_00291043 predicted 711
9 SASI_Hs01_00291044 predicted 699
10 SASI_Hs01_00291045 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044509 predicted 279
2 SASI_Rn01_00044510 predicted 370
3 SASI_Rn01_00044511 predicted 215
4 SASI_Rn01_00044512 predicted 219
5 SASI_Rn02_00269316 predicted 679
6 SASI_Rn01_00044513 predicted 509
7 SASI_Rn02_00269317 predicted 829
8 SASI_Rn01_00044515 predicted 663
9 SASI_Rn01_00044516 predicted 1062
10 SASI_Rn01_00044517 predicted 372
11 SASI_Rn01_00044508 predicted 854
12 SASI_Rn01_00044514 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295601 predicted 847
2 SASI_Mm02_00295602 predicted 621
3 SASI_Mm02_00295603 predicted 292
4 SASI_Mm02_00295604 predicted 475
5 SASI_Mm02_00295605 predicted 511
6 SASI_Mm02_00295606 predicted 863
7 SASI_Mm02_00295607 predicted 612
8 SASI_Mm02_00295608 predicted 268
9 SASI_Mm02_00295609 predicted 212
10 SASI_Mm02_00295610 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_144196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270251 predicted 850
2 SASI_Mm01_00270252 predicted 626
3 SASI_Mm01_00270253 predicted 759
4 SASI_Mm01_00270254 predicted 939
5 SASI_Mm01_00270255 predicted 861
6 SASI_Mm01_00270256 predicted 608
7 SASI_Mm01_00270257 predicted 649
8 SASI_Mm01_00270258 predicted 668
9 SASI_Mm01_00270259 predicted 661
10 SASI_Mm01_00270260 predicted 887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102386
GNAT3 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein, alpha transducing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-264s21c1
Sequence:CCGGGACTACCCTTGGAATTGATTACTCGAGTAATCAATTCCAAGGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-362s21c1
Sequence:CCGGCTCAACTGGCTGAGGTAATAACTCGAGTTATTACCTCAGCCAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-97s21c1
Sequence:CCGGACCGTAAAGCTGCTACTATTACTCGAGTAATAGTAGCAGCTTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-233s21c1
Sequence:CCGGTGCAATCCATCCTAGCTATTGCTCGAGCAATAGCTAGGATGGATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-831s21c1
Sequence:CCGGGGTAACCAAGGTGCATCTTAGCTCGAGCTAAGATGCACCTTGGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102386
GNAT3 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein, alpha transducing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-264s21c1
Sequence:CCGGGACTACCCTTGGAATTGATTACTCGAGTAATCAATTCCAAGGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-362s21c1
Sequence:CCGGCTCAACTGGCTGAGGTAATAACTCGAGTTATTACCTCAGCCAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-97s21c1
Sequence:CCGGACCGTAAAGCTGCTACTATTACTCGAGTAATAGTAGCAGCTTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-233s21c1
Sequence:CCGGTGCAATCCATCCTAGCTATTGCTCGAGCAATAGCTAGGATGGATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-831s21c1
Sequence:CCGGGGTAACCAAGGTGCATCTTAGCTCGAGCTAAGATGCACCTTGGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102386
GNAT3 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein, alpha transducing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-264s21c1
Sequence:CCGGGACTACCCTTGGAATTGATTACTCGAGTAATCAATTCCAAGGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-362s21c1
Sequence:CCGGCTCAACTGGCTGAGGTAATAACTCGAGTTATTACCTCAGCCAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-97s21c1
Sequence:CCGGACCGTAAAGCTGCTACTATTACTCGAGTAATAGTAGCAGCTTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-233s21c1
Sequence:CCGGTGCAATCCATCCTAGCTATTGCTCGAGCAATAGCTAGGATGGATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102386.1-831s21c1
Sequence:CCGGGGTAACCAAGGTGCATCTTAGCTCGAGCTAAGATGCACCTTGGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081143
GNAT3 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein, alpha transducing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-299s21c1
Sequence:CCGGCAAGAATGCATGGAGTTTAAACTCGAGTTTAAACTCCATGCATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-961s21c1
Sequence:CCGGCATTTGCTTTCCAGAATATACCTCGAGGTATATTCTGGAAAGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-262s21c1
Sequence:CCGGACAAATGAAGATCATCCATAACTCGAGTTATGGATGATCTTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-445s21c1
Sequence:CCGGTACACTAGAAGATGGTGATATCTCGAGATATCACCATCTTCTAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-655s21c1
Sequence:CCGGTGGTATCATTGAAACTCAATTCTCGAGAATTGAGTTTCAATGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081143
GNAT3 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein, alpha transducing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-299s21c1
Sequence:CCGGCAAGAATGCATGGAGTTTAAACTCGAGTTTAAACTCCATGCATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-961s21c1
Sequence:CCGGCATTTGCTTTCCAGAATATACCTCGAGGTATATTCTGGAAAGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-262s21c1
Sequence:CCGGACAAATGAAGATCATCCATAACTCGAGTTATGGATGATCTTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-445s21c1
Sequence:CCGGTACACTAGAAGATGGTGATATCTCGAGATATCACCATCTTCTAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-655s21c1
Sequence:CCGGTGGTATCATTGAAACTCAATTCTCGAGAATTGAGTTTCAATGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081143
GNAT3 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein, alpha transducing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-299s21c1
Sequence:CCGGCAAGAATGCATGGAGTTTAAACTCGAGTTTAAACTCCATGCATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-961s21c1
Sequence:CCGGCATTTGCTTTCCAGAATATACCTCGAGGTATATTCTGGAAAGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-262s21c1
Sequence:CCGGACAAATGAAGATCATCCATAACTCGAGTTATGGATGATCTTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-445s21c1
Sequence:CCGGTACACTAGAAGATGGTGATATCTCGAGATATCACCATCTTCTAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081143.1-655s21c1
Sequence:CCGGTGGTATCATTGAAACTCAATTCTCGAGAATTGAGTTTCAATGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks