EMAIL THIS PAGE TO A FRIEND

GNAZ

guanine nucleotide binding protein (G protein), alpha z polypeptide

74 Gene Product Result for
UniProtKB ID: P19086, B2R6C1, Q4QRJ6
Gene ID:
Human(2781) Summary: The protein encoded by this gene is a member of a G protein subfamily that mediates signal transduction in pertussis toxin-insensitive systms. This encoded protein may play a role in maintaining the ionic balance of perilymphatic and endolymphatic cochlear fluids. [provided by RefSeq, Jul 2008]
Mouse(14687) guanine nucleotide binding protein, alpha z subunit
Rat(25740) guanine nucleotide binding protein (G protein), alpha z polypeptide
Zebrafish(564915) guanine nucleotide binding protein (G protein), alpha z polypeptide
chicken(770226) guanine nucleotide binding protein (G protein), alpha z polypeptide
dog(607445) guanine nucleotide binding protein (G protein), alpha z polypeptide
domestic cat(101100923) guanine nucleotide binding protein (G protein), alpha z polypeptide
cow(281200) guanine nucleotide binding protein (G protein), alpha z polypeptide
domestic guinea pig(100728567) guanine nucleotide binding protein (G protein), alpha z polypeptide
naked mole-rat(101714256) guanine nucleotide binding protein (G protein), alpha z polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002073 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010311 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010311 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010311 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002073 Rosetta Predictions human pricing
NM_013189 Rosetta Predictions rat pricing
NM_010311 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245862 predicted 961
2 SASI_Hs01_00245863 predicted 1482
3 SASI_Hs01_00245864 predicted 841
4 SASI_Hs01_00245865 predicted 1229
5 SASI_Hs01_00245866 predicted 1551
6 SASI_Hs01_00245867 predicted 870
7 SASI_Hs01_00245868 predicted 806
8 SASI_Hs01_00245869 predicted 1483
9 SASI_Hs01_00245870 predicted 1445
10 SASI_Hs01_00245871 predicted 1384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077043 predicted 701
2 SASI_Rn02_00261034 predicted 576
3 SASI_Rn01_00077045 predicted 281
4 SASI_Rn01_00077046 predicted 1000
5 SASI_Rn02_00261035 predicted 914
6 SASI_Rn01_00077047 predicted 348
7 SASI_Rn02_00261036 predicted 963
8 SASI_Rn01_00077049 predicted 281
9 SASI_Rn01_00077051 predicted 851
10 SASI_Rn02_00261037 predicted 385
11 SASI_Rn01_00077044 predicted 1358
12 SASI_Rn01_00077048 predicted 1703
13 SASI_Rn01_00077050 predicted 948
14 SASI_Rn01_00077052 predicted 1589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088293 predicted 964
2 SASI_Mm01_00088294 predicted 1648
3 SASI_Mm01_00088295 predicted 1688
4 SASI_Mm01_00088296 predicted 1652
5 SASI_Mm01_00088297 predicted 1057
6 SASI_Mm01_00088298 predicted 1228
7 SASI_Mm01_00088299 predicted 970
8 SASI_Mm01_00088300 predicted 1528
9 SASI_Mm01_00088301 predicted 1559
10 SASI_Mm01_00088302 predicted 1043
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002073
VALIDATED
GNAZ MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha z polypeptide
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-807s21c1
Sequence:CCGGCCTCAGGATCGACTTCCACAACTCGAGTTGTGGAAGTCGATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-1522s21c1
Sequence:CCGGGACACCAGTAACATCCAGTTTCTCGAGAAACTGGATGTTACTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-1233s21c1
Sequence:CCGGCCTGAAACTCTACGAGGATAACTCGAGTTATCCTCGTAGAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-1392s21c1
Sequence:CCGGCATCTGCTTTCCCGAGTACAACTCGAGTTGTACTCGGGAAAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-1573s21c1
Sequence:CCGGCAGAACAATCTCAAGTACATTCTCGAGAATGTACTTGAGATTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002073.2-1573s1c1
Sequence:CCGGCAGAACAATCTCAAGTACATTCTCGAGAATGTACTTGAGATTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002073.2-1233s1c1
Sequence:CCGGCCTGAAACTCTACGAGGATAACTCGAGTTATCCTCGTAGAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002073.2-1392s1c1
Sequence:CCGGCATCTGCTTTCCCGAGTACAACTCGAGTTGTACTCGGGAAAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002073.2-1522s1c1
Sequence:CCGGGACACCAGTAACATCCAGTTTCTCGAGAAACTGGATGTTACTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002073.2-807s1c1
Sequence:CCGGCCTCAGGATCGACTTCCACAACTCGAGTTGTGGAAGTCGATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002073
VALIDATED
GNAZ MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha z polypeptide
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-807s21c1
Sequence:CCGGCCTCAGGATCGACTTCCACAACTCGAGTTGTGGAAGTCGATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-1522s21c1
Sequence:CCGGGACACCAGTAACATCCAGTTTCTCGAGAAACTGGATGTTACTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-1233s21c1
Sequence:CCGGCCTGAAACTCTACGAGGATAACTCGAGTTATCCTCGTAGAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-1392s21c1
Sequence:CCGGCATCTGCTTTCCCGAGTACAACTCGAGTTGTACTCGGGAAAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-1573s21c1
Sequence:CCGGCAGAACAATCTCAAGTACATTCTCGAGAATGTACTTGAGATTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002073.2-1573s1c1
Sequence:CCGGCAGAACAATCTCAAGTACATTCTCGAGAATGTACTTGAGATTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002073.2-1233s1c1
Sequence:CCGGCCTGAAACTCTACGAGGATAACTCGAGTTATCCTCGTAGAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002073.2-1392s1c1
Sequence:CCGGCATCTGCTTTCCCGAGTACAACTCGAGTTGTACTCGGGAAAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002073.2-1522s1c1
Sequence:CCGGGACACCAGTAACATCCAGTTTCTCGAGAAACTGGATGTTACTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002073.2-807s1c1
Sequence:CCGGCCTCAGGATCGACTTCCACAACTCGAGTTGTGGAAGTCGATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002073
VALIDATED
GNAZ MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha z polypeptide
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-807s21c1
Sequence:CCGGCCTCAGGATCGACTTCCACAACTCGAGTTGTGGAAGTCGATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-1522s21c1
Sequence:CCGGGACACCAGTAACATCCAGTTTCTCGAGAAACTGGATGTTACTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-1233s21c1
Sequence:CCGGCCTGAAACTCTACGAGGATAACTCGAGTTATCCTCGTAGAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-1392s21c1
Sequence:CCGGCATCTGCTTTCCCGAGTACAACTCGAGTTGTACTCGGGAAAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002073.2-1573s21c1
Sequence:CCGGCAGAACAATCTCAAGTACATTCTCGAGAATGTACTTGAGATTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002073.2-1573s1c1
Sequence:CCGGCAGAACAATCTCAAGTACATTCTCGAGAATGTACTTGAGATTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002073.2-1233s1c1
Sequence:CCGGCCTGAAACTCTACGAGGATAACTCGAGTTATCCTCGTAGAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002073.2-1392s1c1
Sequence:CCGGCATCTGCTTTCCCGAGTACAACTCGAGTTGTACTCGGGAAAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002073.2-1522s1c1
Sequence:CCGGGACACCAGTAACATCCAGTTTCTCGAGAAACTGGATGTTACTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002073.2-807s1c1
Sequence:CCGGCCTCAGGATCGACTTCCACAACTCGAGTTGTGGAAGTCGATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010311
GNAZ MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha z polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010311.2-2048s1c1
Sequence:CCGGCGTCAAGGTTTCCTGAAGTTTCTCGAGAAACTTCAGGAAACCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010311.2-790s1c1
Sequence:CCGGCAGCGCCGTGAAATCAAACTTCTCGAGAAGTTTGATTTCACGGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010311.2-1717s1c1
Sequence:CCGGGCAGTGACAGATGTCATCATACTCGAGTATGATGACATCTGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010311.2-1449s1c1
Sequence:CCGGCCTCTTTGACTCCATCTGCAACTCGAGTTGCAGATGGAGTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010311.2-1722s1c1
Sequence:CCGGGACAGATGTCATCATACAGAACTCGAGTTCTGTATGATGACATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010311
GNAZ MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha z polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010311.2-2048s1c1
Sequence:CCGGCGTCAAGGTTTCCTGAAGTTTCTCGAGAAACTTCAGGAAACCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010311.2-790s1c1
Sequence:CCGGCAGCGCCGTGAAATCAAACTTCTCGAGAAGTTTGATTTCACGGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010311.2-1717s1c1
Sequence:CCGGGCAGTGACAGATGTCATCATACTCGAGTATGATGACATCTGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010311.2-1449s1c1
Sequence:CCGGCCTCTTTGACTCCATCTGCAACTCGAGTTGCAGATGGAGTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010311.2-1722s1c1
Sequence:CCGGGACAGATGTCATCATACAGAACTCGAGTTCTGTATGATGACATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010311
GNAZ MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha z polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010311.2-2048s1c1
Sequence:CCGGCGTCAAGGTTTCCTGAAGTTTCTCGAGAAACTTCAGGAAACCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010311.2-790s1c1
Sequence:CCGGCAGCGCCGTGAAATCAAACTTCTCGAGAAGTTTGATTTCACGGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010311.2-1717s1c1
Sequence:CCGGGCAGTGACAGATGTCATCATACTCGAGTATGATGACATCTGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010311.2-1449s1c1
Sequence:CCGGCCTCTTTGACTCCATCTGCAACTCGAGTTGCAGATGGAGTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010311.2-1722s1c1
Sequence:CCGGGACAGATGTCATCATACAGAACTCGAGTTCTGTATGATGACATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks