EMAIL THIS PAGE TO A FRIEND

GNB1

guanine nucleotide binding protein (G protein), beta polypeptide 1

96 Gene Product Result for
UniProtKB ID: P62873, B1AJZ7, P04697, P04901
Gene ID:
Human(2782) Summary: Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. This gene uses alternative polyadenylation signals. [provided by RefSeq, Jul 2008]
Mouse(14688) guanine nucleotide binding protein (G protein), beta 1
Rat(24400) guanine nucleotide binding protein (G protein), beta polypeptide 1
chicken(419402) guanine nucleotide binding protein (G protein), beta polypeptide 1
cow(281201) guanine nucleotide binding protein (G protein), beta polypeptide 1
Horse(100061395) guanine nucleotide binding protein (G protein), beta polypeptide 1
dog(403912) guanine nucleotide binding protein (G protein), beta polypeptide 1
domestic guinea pig(100216360) guanine nucleotide binding protein (G protein), beta 1
naked mole-rat(101703108) guanine nucleotide binding protein (G protein), beta polypeptide 1
sheep(101104166) guanine nucleotide binding protein (G protein), beta polypeptide 1
Domestic Rabbit(100337783) guanine nucleotide binding protein (G protein), beta polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108145 Anti-GNB1 antibody produced in rabbit affinity isolated antibody canine, mouse, guinea pig, horse, human, bovine, rat, rabbit
western blot pricing
SAB2701168 Anti-GNB1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104936 Anti-GNB1, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, canine, human, guinea pig, horse, mouse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002074 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008142 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008142 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008142 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002074 Rosetta Predictions human pricing
NM_030987 Rosetta Predictions rat pricing
NM_008142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246214 predicted 1420
2 SASI_Hs01_00246216 predicted 1433
3 SASI_Hs01_00246217 predicted 1341
4 SASI_Hs01_00246218 predicted 392
5 SASI_Hs01_00246219 predicted 671
6 SASI_Hs01_00246220 predicted 379
7 SASI_Hs01_00246221 predicted 1077
8 SASI_Hs02_00333146 predicted 1029
9 SASI_Hs02_00333147 predicted 938
10 SASI_Hs01_00246223 predicted 681
11 SASI_Hs01_00246215 predicted 1025
12 SASI_Hs01_00246222 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109866 predicted 892
2 SASI_Rn01_00109867 predicted 560
3 SASI_Rn02_00264148 predicted 252
4 SASI_Rn01_00109869 predicted 830
5 SASI_Rn01_00109870 predicted 403
6 SASI_Rn01_00109871 predicted 533
7 SASI_Rn01_00109872 predicted 937
8 SASI_Rn01_00109873 predicted 836
9 SASI_Rn02_00264149 predicted 260
10 SASI_Rn02_00264150 predicted 956
11 SASI_Rn01_00109868 predicted 630
12 SASI_Rn01_00109874 predicted 722
13 SASI_Rn01_00109875 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313228 predicted 619
2 SASI_Mm02_00313229 predicted 312
3 SASI_Mm02_00313230 predicted 789
4 SASI_Mm02_00313231 predicted 645
5 SASI_Mm01_00033128 predicted 798
6 SASI_Mm02_00313232 predicted 451
7 SASI_Mm01_00033129 predicted 914
8 SASI_Mm01_00033130 predicted 695
9 SASI_Mm01_00033131 predicted 751
10 SASI_Mm02_00313233 predicted 403
11 SASI_Mm01_00033126 predicted 1103
12 SASI_Mm01_00033127 predicted 334
13 SASI_Mm01_00033132 predicted 836
14 SASI_Mm01_00033133 predicted 348
15 SASI_Mm01_00033134 predicted 688
16 SASI_Mm01_00033135 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002074
VALIDATED
GNB1 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), beta polypeptide 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002074.2-365s1c1
Sequence:CCGGCGAGCAACTTAAGAACCAGATCTCGAGATCTGGTTCTTAAGTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002074.2-554s1c1
Sequence:CCGGGCAGGATGGTAAACTTATCATCTCGAGATGATAAGTTTACCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002074.2-939s1c1
Sequence:CCGGGCTTGTGATGCTTCAGCCAAACTCGAGTTTGGCTGAAGCATCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002074.2-681s1c1
Sequence:CCGGCTGGATAACATTTGCTCCATTCTCGAGAATGGAGCAAATGTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002074.2-1023s1c1
Sequence:CCGGGCCATTTGCTTCTTTCCAAATCTCGAGATTTGGAAAGAAGCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002074.2-1426s21c1
Sequence:CCGGATCCTATCCAACCGTACTAACCTCGAGGTTAGTACGGTTGGATAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002074.2-1661s21c1
Sequence:CCGGGAAGGTAAACTTGAGTGTAATCTCGAGATTACACTCAAGTTTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002074.2-417s21c1
Sequence:CCGGACTCTCTCTCAGATCACAAACCTCGAGGTTTGTGATCTGAGAGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002074
VALIDATED
GNB1 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), beta polypeptide 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002074.2-365s1c1
Sequence:CCGGCGAGCAACTTAAGAACCAGATCTCGAGATCTGGTTCTTAAGTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002074.2-554s1c1
Sequence:CCGGGCAGGATGGTAAACTTATCATCTCGAGATGATAAGTTTACCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002074.2-939s1c1
Sequence:CCGGGCTTGTGATGCTTCAGCCAAACTCGAGTTTGGCTGAAGCATCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002074.2-681s1c1
Sequence:CCGGCTGGATAACATTTGCTCCATTCTCGAGAATGGAGCAAATGTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002074.2-1023s1c1
Sequence:CCGGGCCATTTGCTTCTTTCCAAATCTCGAGATTTGGAAAGAAGCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002074.2-1426s21c1
Sequence:CCGGATCCTATCCAACCGTACTAACCTCGAGGTTAGTACGGTTGGATAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002074.2-1661s21c1
Sequence:CCGGGAAGGTAAACTTGAGTGTAATCTCGAGATTACACTCAAGTTTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002074.2-417s21c1
Sequence:CCGGACTCTCTCTCAGATCACAAACCTCGAGGTTTGTGATCTGAGAGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002074
VALIDATED
GNB1 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), beta polypeptide 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002074.2-365s1c1
Sequence:CCGGCGAGCAACTTAAGAACCAGATCTCGAGATCTGGTTCTTAAGTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002074.2-554s1c1
Sequence:CCGGGCAGGATGGTAAACTTATCATCTCGAGATGATAAGTTTACCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002074.2-939s1c1
Sequence:CCGGGCTTGTGATGCTTCAGCCAAACTCGAGTTTGGCTGAAGCATCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002074.2-681s1c1
Sequence:CCGGCTGGATAACATTTGCTCCATTCTCGAGAATGGAGCAAATGTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002074.2-1023s1c1
Sequence:CCGGGCCATTTGCTTCTTTCCAAATCTCGAGATTTGGAAAGAAGCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002074.2-1426s21c1
Sequence:CCGGATCCTATCCAACCGTACTAACCTCGAGGTTAGTACGGTTGGATAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002074.2-1661s21c1
Sequence:CCGGGAAGGTAAACTTGAGTGTAATCTCGAGATTACACTCAAGTTTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002074.2-417s21c1
Sequence:CCGGACTCTCTCTCAGATCACAAACCTCGAGGTTTGTGATCTGAGAGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008142
VALIDATED
GNB1 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), beta polypeptide 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-1481s1c1
Sequence:CCGGGCTGAAACCAAGAGCACAATTCTCGAGAATTGTGCTCTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-383s1c1
Sequence:CCGGCGACTCTTTCTCAGATCACAACTCGAGTTGTGATCTGAGAAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-821s1c1
Sequence:CCGGGCCAGCAGACAACCACATTTACTCGAGTAAATGTGGTTGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-348s1c1
Sequence:CCGGCCAAATTAGAGATGCTCGTAACTCGAGTTACGAGCATCTCTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-1088s1c1
Sequence:CCGGCCTACTCCCATGACAACATTACTCGAGTAATGTTGTCATGGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008142.3-1187s21c1
Sequence:CCGGGCTGAAACCAAGAGCACAATTCTCGAGAATTGTGCTCTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008142.3-791s21c1
Sequence:CCGGCCTACTCCCATGACAACATTACTCGAGTAATGTTGTCATGGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008142.3-86s21c1
Sequence:CCGGCGACTCTTTCTCAGATCACAACTCGAGTTGTGATCTGAGAAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008142.3-51s21c1
Sequence:CCGGCCAAATTAGAGATGCTCGTAACTCGAGTTACGAGCATCTCTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008142.3-524s21c1
Sequence:CCGGGCCAGCAGACAACCACATTTACTCGAGTAAATGTGGTTGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008142
VALIDATED
GNB1 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), beta polypeptide 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-1481s1c1
Sequence:CCGGGCTGAAACCAAGAGCACAATTCTCGAGAATTGTGCTCTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-383s1c1
Sequence:CCGGCGACTCTTTCTCAGATCACAACTCGAGTTGTGATCTGAGAAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-821s1c1
Sequence:CCGGGCCAGCAGACAACCACATTTACTCGAGTAAATGTGGTTGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-348s1c1
Sequence:CCGGCCAAATTAGAGATGCTCGTAACTCGAGTTACGAGCATCTCTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-1088s1c1
Sequence:CCGGCCTACTCCCATGACAACATTACTCGAGTAATGTTGTCATGGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008142.3-1187s21c1
Sequence:CCGGGCTGAAACCAAGAGCACAATTCTCGAGAATTGTGCTCTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008142.3-791s21c1
Sequence:CCGGCCTACTCCCATGACAACATTACTCGAGTAATGTTGTCATGGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008142.3-86s21c1
Sequence:CCGGCGACTCTTTCTCAGATCACAACTCGAGTTGTGATCTGAGAAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008142.3-51s21c1
Sequence:CCGGCCAAATTAGAGATGCTCGTAACTCGAGTTACGAGCATCTCTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008142.3-524s21c1
Sequence:CCGGGCCAGCAGACAACCACATTTACTCGAGTAAATGTGGTTGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008142
VALIDATED
GNB1 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), beta polypeptide 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-1481s1c1
Sequence:CCGGGCTGAAACCAAGAGCACAATTCTCGAGAATTGTGCTCTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-383s1c1
Sequence:CCGGCGACTCTTTCTCAGATCACAACTCGAGTTGTGATCTGAGAAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-821s1c1
Sequence:CCGGGCCAGCAGACAACCACATTTACTCGAGTAAATGTGGTTGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-348s1c1
Sequence:CCGGCCAAATTAGAGATGCTCGTAACTCGAGTTACGAGCATCTCTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008142.2-1088s1c1
Sequence:CCGGCCTACTCCCATGACAACATTACTCGAGTAATGTTGTCATGGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008142.3-1187s21c1
Sequence:CCGGGCTGAAACCAAGAGCACAATTCTCGAGAATTGTGCTCTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008142.3-791s21c1
Sequence:CCGGCCTACTCCCATGACAACATTACTCGAGTAATGTTGTCATGGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008142.3-86s21c1
Sequence:CCGGCGACTCTTTCTCAGATCACAACTCGAGTTGTGATCTGAGAAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008142.3-51s21c1
Sequence:CCGGCCAAATTAGAGATGCTCGTAACTCGAGTTACGAGCATCTCTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008142.3-524s21c1
Sequence:CCGGGCCAGCAGACAACCACATTTACTCGAGTAAATGTGGTTGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks