EMAIL THIS PAGE TO A FRIEND

GNB1L

guanine nucleotide binding protein (G protein), beta polypeptide 1-like

56 Gene Product Result for
Synonyms: DGCRK3 GY2 WDR14 WDVCF
UniProtKB ID: Q9BYB4, Q9H2S2, Q9H4M4
Gene ID:
Human(54584) Summary: This gene encodes a G-protein beta-subunit-like polypeptide which is a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 6 WD repeats and is highly expressed in the heart. The gene maps to the region on chromosome 22q11, which is deleted in DiGeorge syndrome, trisomic in derivative 22 syndrome and tetrasomic in cat-eye syndrome. Therefore, this gene may contribute to the etiology of those disorders. Transcripts from this gene share exons with some transcripts from the C22orf29 gene. [provided by RefSeq, Jul 2008]
Mouse(13972) guanine nucleotide binding protein (G protein), beta polypeptide 1-like
Rat(680266) guanine nucleotide binding protein (G protein), beta polypeptide 1-like
Zebrafish(541381) guanine nucleotide binding protein (G protein), beta polypeptide 1-like
dog(486418) guanine nucleotide binding protein (G protein), beta polypeptide 1-like
cow(513071) guanine nucleotide binding protein (G protein), beta polypeptide 1-like
domestic cat(101097276) guanine nucleotide binding protein (G protein), beta polypeptide 1-like
chicken(416781) guanine nucleotide binding protein (G protein), beta polypeptide 1-like
domestic guinea pig(100736062) guanine nucleotide binding protein (G protein), beta polypeptide 1-like
naked mole-rat(101719460) guanine nucleotide binding protein (G protein), beta polypeptide 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053004 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023120 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023120 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023120 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053004 Rosetta Predictions human pricing
XM_001057185 Rosetta Predictions rat pricing
NM_001081682 Rosetta Predictions mouse pricing
NM_023120 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053607 predicted 1186
2 SASI_Hs01_00053608 predicted 1198
3 SASI_Hs01_00053609 predicted 856
4 SASI_Hs01_00053611 predicted 358
5 SASI_Hs01_00053612 predicted 1284
6 SASI_Hs01_00053613 predicted 708
7 SASI_Hs01_00053614 predicted 1063
8 SASI_Hs01_00053615 predicted 864
9 SASI_Hs01_00053616 predicted 1132
10 SASI_Hs02_00361835 predicted 1134
11 SASI_Hs01_00053610 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285687 predicted 369
2 SASI_Rn02_00285688 predicted 711
3 SASI_Rn02_00285689 predicted 786
4 SASI_Rn02_00285690 predicted 1063
5 SASI_Rn02_00285691 predicted 1107
6 SASI_Rn02_00285692 predicted 824
7 SASI_Rn02_00285693 predicted 586
8 SASI_Rn02_00285694 predicted 992
9 SASI_Rn02_00285695 predicted 993
10 SASI_Rn02_00285696 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298985 predicted 737
2 SASI_Mm02_00298986 predicted 1387
3 SASI_Mm02_00298987 predicted 352
4 SASI_Mm02_00298988 predicted 815
5 SASI_Mm02_00298989 predicted 324
6 SASI_Mm02_00298990 predicted 1476
7 SASI_Mm02_00298991 predicted 930
8 SASI_Mm02_00298992 predicted 1132
9 SASI_Mm02_00298993 predicted 337
10 SASI_Mm02_00298994 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023120 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108665 predicted 734
2 SASI_Mm01_00108666 predicted 1381
3 SASI_Mm01_00108667 predicted 352
4 SASI_Mm01_00108668 predicted 817
5 SASI_Mm01_00108669 predicted 315
6 SASI_Mm01_00108670 predicted 1469
7 SASI_Mm02_00326812 predicted 927
8 SASI_Mm01_00108671 predicted 1131
9 SASI_Mm01_00108673 predicted 332
10 SASI_Mm02_00326813 predicted 752
11 SASI_Mm01_00108664 predicted 1336
12 SASI_Mm01_00108672 predicted 234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053004
GNB1L MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), beta polypeptide 1-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053004.2-789s21c1
Sequence:CCGGCTATGAGGATGGATCGGTGGTCTCGAGACCACCGATCCATCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053004.2-1017s21c1
Sequence:CCGGGATCCGGCCAGATCGCAAGATCTCGAGATCTTGCGATCTGGCCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-651s1c1
Sequence:CCGGCGAGGTTCAGATTCTGGAGATCTCGAGATCTCCAGAATCTGAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-378s1c1
Sequence:CCGGCCTGGTACACATCTGGAGCCTCTCGAGAGGCTCCAGATGTGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-1188s1c1
Sequence:CCGGGATCAGCCTCTGGTCACTCTACTCGAGTAGAGTGACCAGAGGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-1071s1c1
Sequence:CCGGCGTGTTCCACTGGCGGACGATCTCGAGATCGTCCGCCAGTGGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-864s1c1
Sequence:CCGGGCCCGTCATGGACCTTGACTTCTCGAGAAGTCAAGGTCCATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053004
GNB1L MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), beta polypeptide 1-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053004.2-789s21c1
Sequence:CCGGCTATGAGGATGGATCGGTGGTCTCGAGACCACCGATCCATCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053004.2-1017s21c1
Sequence:CCGGGATCCGGCCAGATCGCAAGATCTCGAGATCTTGCGATCTGGCCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-651s1c1
Sequence:CCGGCGAGGTTCAGATTCTGGAGATCTCGAGATCTCCAGAATCTGAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-378s1c1
Sequence:CCGGCCTGGTACACATCTGGAGCCTCTCGAGAGGCTCCAGATGTGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-1188s1c1
Sequence:CCGGGATCAGCCTCTGGTCACTCTACTCGAGTAGAGTGACCAGAGGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-1071s1c1
Sequence:CCGGCGTGTTCCACTGGCGGACGATCTCGAGATCGTCCGCCAGTGGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-864s1c1
Sequence:CCGGGCCCGTCATGGACCTTGACTTCTCGAGAAGTCAAGGTCCATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053004
GNB1L MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), beta polypeptide 1-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053004.2-789s21c1
Sequence:CCGGCTATGAGGATGGATCGGTGGTCTCGAGACCACCGATCCATCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053004.2-1017s21c1
Sequence:CCGGGATCCGGCCAGATCGCAAGATCTCGAGATCTTGCGATCTGGCCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-651s1c1
Sequence:CCGGCGAGGTTCAGATTCTGGAGATCTCGAGATCTCCAGAATCTGAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-378s1c1
Sequence:CCGGCCTGGTACACATCTGGAGCCTCTCGAGAGGCTCCAGATGTGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-1188s1c1
Sequence:CCGGGATCAGCCTCTGGTCACTCTACTCGAGTAGAGTGACCAGAGGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-1071s1c1
Sequence:CCGGCGTGTTCCACTGGCGGACGATCTCGAGATCGTCCGCCAGTGGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053004.1-864s1c1
Sequence:CCGGGCCCGTCATGGACCTTGACTTCTCGAGAAGTCAAGGTCCATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023120
VALIDATED
GNB1L MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), beta polypeptide 1-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000037034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023120.1-310s1c1
Sequence:CCGGGAAGAATAGTTACCACTCTAACTCGAGTTAGAGTGGTAACTATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023120.1-984s1c1
Sequence:CCGGTGGAGGACAATGAAACCGTTACTCGAGTAACGGTTTCATTGTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023120.1-691s1c1
Sequence:CCGGGCTATGAGGATGGATCAGTAACTCGAGTTACTGATCCATCCTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023120.1-202s1c1
Sequence:CCGGCGGCTGTGAACACGCTCCATTCTCGAGAATGGAGCGTGTTCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023120
VALIDATED
GNB1L MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), beta polypeptide 1-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000037034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023120.1-310s1c1
Sequence:CCGGGAAGAATAGTTACCACTCTAACTCGAGTTAGAGTGGTAACTATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023120.1-984s1c1
Sequence:CCGGTGGAGGACAATGAAACCGTTACTCGAGTAACGGTTTCATTGTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023120.1-691s1c1
Sequence:CCGGGCTATGAGGATGGATCAGTAACTCGAGTTACTGATCCATCCTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023120.1-202s1c1
Sequence:CCGGCGGCTGTGAACACGCTCCATTCTCGAGAATGGAGCGTGTTCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023120
VALIDATED
GNB1L MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), beta polypeptide 1-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000037034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023120.1-310s1c1
Sequence:CCGGGAAGAATAGTTACCACTCTAACTCGAGTTAGAGTGGTAACTATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023120.1-984s1c1
Sequence:CCGGTGGAGGACAATGAAACCGTTACTCGAGTAACGGTTTCATTGTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023120.1-691s1c1
Sequence:CCGGGCTATGAGGATGGATCAGTAACTCGAGTTACTGATCCATCCTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023120.1-202s1c1
Sequence:CCGGCGGCTGTGAACACGCTCCATTCTCGAGAATGGAGCGTGTTCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks