EMAIL THIS PAGE TO A FRIEND

GNB2

guanine nucleotide binding protein (G protein), beta polypeptide 2

90 Gene Product Result for
UniProtKB ID: P62879, P11016, P54312
Gene ID:
Human(2783) Summary: Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. This gene contains a trinucleotide (CCG) repeat length polymorphism in its 5' UTR. [provided by RefSeq, Jul 2008]
Mouse(14693) guanine nucleotide binding protein (G protein), beta 2
Rat(81667) guanine nucleotide binding protein (G protein), beta polypeptide 2
domestic guinea pig(100718398) guanine nucleotide binding protein (G protein), beta polypeptide 2
naked mole-rat(101711479) guanine nucleotide binding protein (G protein), beta polypeptide 2
sheep(101102864) guanine nucleotide binding protein (G protein), beta polypeptide 2
Domestic Rabbit(100356799) guanine nucleotide binding protein (G protein), beta polypeptide 2
Zebrafish(541370) guanine nucleotide binding protein (G protein), beta polypeptide 2
dog(479733) guanine nucleotide binding protein (G protein), beta polypeptide 2
cow(281202) guanine nucleotide binding protein (G protein), beta polypeptide 2
Horse(100067486) guanine nucleotide binding protein (G protein), beta polypeptide 2
domestic cat(101093317) guanine nucleotide binding protein (G protein), beta polypeptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010312 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010312 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010312 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005273 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005273 Rosetta Predictions human pricing
NM_031037 Rosetta Predictions rat pricing
NM_010312 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145229 predicted 897
2 SASI_Hs01_00145230 predicted 894
3 SASI_Hs02_00339319 predicted 929
4 SASI_Hs01_00145231 predicted 1041
5 SASI_Hs01_00145232 predicted 1024
6 SASI_Hs01_00145233 predicted 862
7 SASI_Hs01_00145234 predicted 909
8 SASI_Hs01_00145235 predicted 927
9 SASI_Hs02_00339320 predicted 933
10 SASI_Hs01_00145237 predicted 864
11 SASI_Hs01_00145236 predicted 1068
12 SASI_Hs01_00145238 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086495 predicted 1004
2 SASI_Rn01_00086496 predicted 875
3 SASI_Rn01_00086497 predicted 1036
4 SASI_Rn01_00086498 predicted 449
5 SASI_Rn01_00086499 predicted 1093
6 SASI_Rn02_00264247 predicted 1186
7 SASI_Rn01_00086501 predicted 599
8 SASI_Rn01_00086502 predicted 863
9 SASI_Rn01_00086503 predicted 646
10 SASI_Rn01_00086504 predicted 465
11 SASI_Rn01_00086500 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126253 predicted 954
2 SASI_Mm01_00126254 predicted 988
3 SASI_Mm02_00318297 predicted 620
4 SASI_Mm01_00126256 predicted 526
5 SASI_Mm01_00126257 predicted 409
6 SASI_Mm01_00126258 predicted 809
7 SASI_Mm02_00318298 predicted 625
8 SASI_Mm01_00126260 predicted 841
9 SASI_Mm01_00126261 predicted 1039
10 SASI_Mm01_00126262 predicted 553
11 SASI_Mm01_00126255 predicted 980
12 SASI_Mm01_00126259 predicted 1078
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010312
VALIDATED
GNB2 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), beta polypeptide 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010312.3-989s1c1
Sequence:CCGGGCTCATGTATTCCCACGACAACTCGAGTTGTCGTGGGAATACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010312.3-429s1c1
Sequence:CCGGCAGGACGGAAAGCTCATCATTCTCGAGAATGATGAGCTTTCCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010312.3-1353s1c1
Sequence:CCGGCCTGCTCCCATACCCAGGTTTCTCGAGAAACCTGGGTATGGGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010312.3-659s1c1
Sequence:CCGGCCTGGACGACAACCAAATCATCTCGAGATGATTTGGTTGTCGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010312.3-1073s1c1
Sequence:CCGGCGACGACTTCAACTGCAACATCTCGAGATGTTGCAGTTGAAGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010312.4-1327s21c2
Sequence:CCGGCCTGCTCCCATACCCAGGTTTCTCGAGAAACCTGGGTATGGGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010312.4-633s21c2
Sequence:CCGGCCTGGACGACAACCAAATCATCTCGAGATGATTTGGTTGTCGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010312.4-963s21c1
Sequence:CCGGGCTCATGTATTCCCACGACAACTCGAGTTGTCGTGGGAATACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010312.4-403s21c1
Sequence:CCGGCAGGACGGAAAGCTCATCATTCTCGAGAATGATGAGCTTTCCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010312.4-1047s21c1
Sequence:CCGGCGACGACTTCAACTGCAACATCTCGAGATGTTGCAGTTGAAGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010312
VALIDATED
GNB2 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), beta polypeptide 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010312.3-989s1c1
Sequence:CCGGGCTCATGTATTCCCACGACAACTCGAGTTGTCGTGGGAATACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010312.3-429s1c1
Sequence:CCGGCAGGACGGAAAGCTCATCATTCTCGAGAATGATGAGCTTTCCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010312.3-1353s1c1
Sequence:CCGGCCTGCTCCCATACCCAGGTTTCTCGAGAAACCTGGGTATGGGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010312.3-659s1c1
Sequence:CCGGCCTGGACGACAACCAAATCATCTCGAGATGATTTGGTTGTCGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010312.3-1073s1c1
Sequence:CCGGCGACGACTTCAACTGCAACATCTCGAGATGTTGCAGTTGAAGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010312.4-1327s21c2
Sequence:CCGGCCTGCTCCCATACCCAGGTTTCTCGAGAAACCTGGGTATGGGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010312.4-633s21c2
Sequence:CCGGCCTGGACGACAACCAAATCATCTCGAGATGATTTGGTTGTCGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010312.4-963s21c1
Sequence:CCGGGCTCATGTATTCCCACGACAACTCGAGTTGTCGTGGGAATACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010312.4-403s21c1
Sequence:CCGGCAGGACGGAAAGCTCATCATTCTCGAGAATGATGAGCTTTCCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010312.4-1047s21c1
Sequence:CCGGCGACGACTTCAACTGCAACATCTCGAGATGTTGCAGTTGAAGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010312
VALIDATED
GNB2 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), beta polypeptide 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010312.3-989s1c1
Sequence:CCGGGCTCATGTATTCCCACGACAACTCGAGTTGTCGTGGGAATACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010312.3-429s1c1
Sequence:CCGGCAGGACGGAAAGCTCATCATTCTCGAGAATGATGAGCTTTCCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010312.3-1353s1c1
Sequence:CCGGCCTGCTCCCATACCCAGGTTTCTCGAGAAACCTGGGTATGGGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010312.3-659s1c1
Sequence:CCGGCCTGGACGACAACCAAATCATCTCGAGATGATTTGGTTGTCGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010312.3-1073s1c1
Sequence:CCGGCGACGACTTCAACTGCAACATCTCGAGATGTTGCAGTTGAAGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010312.4-1327s21c2
Sequence:CCGGCCTGCTCCCATACCCAGGTTTCTCGAGAAACCTGGGTATGGGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010312.4-633s21c2
Sequence:CCGGCCTGGACGACAACCAAATCATCTCGAGATGATTTGGTTGTCGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010312.4-963s21c1
Sequence:CCGGGCTCATGTATTCCCACGACAACTCGAGTTGTCGTGGGAATACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010312.4-403s21c1
Sequence:CCGGCAGGACGGAAAGCTCATCATTCTCGAGAATGATGAGCTTTCCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010312.4-1047s21c1
Sequence:CCGGCGACGACTTCAACTGCAACATCTCGAGATGTTGCAGTTGAAGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005273
VALIDATED
GNB2 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), beta polypeptide 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-939s1c1
Sequence:CCGGCGACATCAATGCAGTGGCTTTCTCGAGAAAGCCACTGCATTGATGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-1316s1c1
Sequence:CCGGGCCCTGCCCATGCCCACACTACTCGAGTAGTGTGGGCATGGGCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-1041s1c1
Sequence:CCGGCCTCATGTACTCCCATGACAACTCGAGTTGTCATGGGAGTACATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-711s1c1
Sequence:CCGGCCTGGATGACAACCAAATCATCTCGAGATGATTTGGTTGTCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-927s1c1
Sequence:CCGGCGGCCATGAATCCGACATCAACTCGAGTTGATGTCGGATTCATGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005273.3-954s21c1
Sequence:CCGGCGACATCAATGCAGTGGCTTTCTCGAGAAAGCCACTGCATTGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005273.3-1056s21c1
Sequence:CCGGCCTCATGTACTCCCATGACAACTCGAGTTGTCATGGGAGTACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005273.3-726s21c1
Sequence:CCGGCCTGGATGACAACCAAATCATCTCGAGATGATTTGGTTGTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005273.3-1331s21c1
Sequence:CCGGGCCCTGCCCATGCCCACACTACTCGAGTAGTGTGGGCATGGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005273.3-942s21c1
Sequence:CCGGCGGCCATGAATCCGACATCAACTCGAGTTGATGTCGGATTCATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005273
VALIDATED
GNB2 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), beta polypeptide 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-939s1c1
Sequence:CCGGCGACATCAATGCAGTGGCTTTCTCGAGAAAGCCACTGCATTGATGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-1316s1c1
Sequence:CCGGGCCCTGCCCATGCCCACACTACTCGAGTAGTGTGGGCATGGGCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-1041s1c1
Sequence:CCGGCCTCATGTACTCCCATGACAACTCGAGTTGTCATGGGAGTACATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-711s1c1
Sequence:CCGGCCTGGATGACAACCAAATCATCTCGAGATGATTTGGTTGTCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-927s1c1
Sequence:CCGGCGGCCATGAATCCGACATCAACTCGAGTTGATGTCGGATTCATGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005273.3-954s21c1
Sequence:CCGGCGACATCAATGCAGTGGCTTTCTCGAGAAAGCCACTGCATTGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005273.3-1056s21c1
Sequence:CCGGCCTCATGTACTCCCATGACAACTCGAGTTGTCATGGGAGTACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005273.3-726s21c1
Sequence:CCGGCCTGGATGACAACCAAATCATCTCGAGATGATTTGGTTGTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005273.3-1331s21c1
Sequence:CCGGGCCCTGCCCATGCCCACACTACTCGAGTAGTGTGGGCATGGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005273.3-942s21c1
Sequence:CCGGCGGCCATGAATCCGACATCAACTCGAGTTGATGTCGGATTCATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005273
VALIDATED
GNB2 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), beta polypeptide 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-939s1c1
Sequence:CCGGCGACATCAATGCAGTGGCTTTCTCGAGAAAGCCACTGCATTGATGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-1316s1c1
Sequence:CCGGGCCCTGCCCATGCCCACACTACTCGAGTAGTGTGGGCATGGGCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-1041s1c1
Sequence:CCGGCCTCATGTACTCCCATGACAACTCGAGTTGTCATGGGAGTACATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-711s1c1
Sequence:CCGGCCTGGATGACAACCAAATCATCTCGAGATGATTTGGTTGTCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005273.2-927s1c1
Sequence:CCGGCGGCCATGAATCCGACATCAACTCGAGTTGATGTCGGATTCATGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005273.3-954s21c1
Sequence:CCGGCGACATCAATGCAGTGGCTTTCTCGAGAAAGCCACTGCATTGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005273.3-1056s21c1
Sequence:CCGGCCTCATGTACTCCCATGACAACTCGAGTTGTCATGGGAGTACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005273.3-726s21c1
Sequence:CCGGCCTGGATGACAACCAAATCATCTCGAGATGATTTGGTTGTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005273.3-1331s21c1
Sequence:CCGGGCCCTGCCCATGCCCACACTACTCGAGTAGTGTGGGCATGGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005273.3-942s21c1
Sequence:CCGGCGGCCATGAATCCGACATCAACTCGAGTTGATGTCGGATTCATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks