EMAIL THIS PAGE TO A FRIEND

GNB2L1

guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1

90 Gene Product Result for
Synonyms: Gnb2-rs1 H12.3 HLC-7 PIG21 RACK1
Gene ID:
Mouse(14694) guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1
Rat(83427) guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1
Zebrafish(30722) guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
chicken(417044) guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
domestic cat(101083735) guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
cow(327682) guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
Horse(100057771) guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
dog(480818) guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
sheep(100137070) guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
domestic guinea pig(100719611) guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
naked mole-rat(101715834) guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501673 Anti-GNB2L1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
SAB2702477 Anti-Gnb2l1 antibody produced in rabbit affinity isolated antibody zebrafish
pricing
AV40625 Anti-GNB2L1 antibody produced in rabbit affinity isolated antibody rabbit, canine, human, guinea pig, horse, pig, rat, zebrafish, mouse, sheep
western blot pricing
HPA021676 Anti-GNB2L1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
SAB2107624 Anti-GNB2L1 antibody produced in rabbit affinity isolated antibody mouse, sheep, guinea pig, rabbit, human
ELISA, western blot pricing
SAB2103410 Anti-GNB2L1, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, rat, human, rabbit, sheep, rabbit, guinea pig, zebrafish, pig,
western blot pricing
R2030 Anti-RACK1 (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution, immunoprecipitation: 5 μg human, rat, mouse
immunoprecipitation, western blot pricing
R1905 Anti-RACK1 (N-terminal) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, rat, human
immunofluorescence, immunoprecipitation, western blot pricing
SAB4100306 Monoclonal Anti-GNB2L1 antibody produced in mouse clone GNB2L1-A259, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008143 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008143 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008143 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006098 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006098 Rosetta Predictions human pricing
NM_130734 Rosetta Predictions rat pricing
NM_008143 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105803 predicted 402
2 SASI_Hs01_00105804 predicted 745
3 SASI_Hs01_00105808 predicted 252
4 SASI_Hs02_00340880 predicted 408
5 SASI_Hs02_00340881 predicted 583
6 SASI_Hs02_00340882 predicted 410
7 SASI_Hs02_00340883 predicted 691
8 SASI_Hs01_00105802 predicted 680
9 SASI_Hs02_00340884 predicted 517
10 SASI_Hs01_00105810 predicted 243
11 SASI_Hs01_00105805 predicted 550
12 SASI_Hs01_00105806 predicted 667
13 SASI_Hs01_00105807 predicted 455
14 SASI_Hs01_00105809 predicted 580
15 SASI_Hs01_00105811 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112861 predicted 386
2 SASI_Rn02_00267458 predicted 528
3 SASI_Rn01_00112863 predicted 278
4 SASI_Rn01_00112864 predicted 596
5 SASI_Rn01_00112865 predicted 261
6 SASI_Rn01_00112866 predicted 434
7 SASI_Rn01_00112867 predicted 377
8 SASI_Rn01_00112868 predicted 479
9 SASI_Rn02_00267459 predicted 566
10 SASI_Rn01_00112869 predicted 375
11 SASI_Rn01_00112862 predicted 204
12 SASI_Rn01_00112870 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078284 predicted 493
2 SASI_Mm01_00078285 predicted 457
3 SASI_Mm01_00078286 predicted 294
4 SASI_Mm01_00078287 predicted 249
5 SASI_Mm01_00078289 predicted 392
6 SASI_Mm01_00078293 predicted 397
7 SASI_Mm02_00313234 predicted 884
8 SASI_Mm02_00313235 predicted 954
9 SASI_Mm02_00313236 predicted 541
10 SASI_Mm02_00313237 predicted 1016
11 SASI_Mm01_00078288 predicted 222
12 SASI_Mm01_00078290 predicted 378
13 SASI_Mm01_00078291 predicted 242
14 SASI_Mm01_00078292 predicted 328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008143
VALIDATED
GNB2L1 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-526s21c1
Sequence:CCGGCGGTCCAGGATGAGAGTCATTCTCGAGAATGACTCTCATCCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-892s21c1
Sequence:CCGGGCAAGATCATTGTAGATGAATCTCGAGATTCATCTACAATGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-1074s21c1
Sequence:CCGGGTCTTAGAAATAAACTGGCTTCTCGAGAAGCCAGTTTATTTCTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-143s21c1
Sequence:CCGGCCACAATGGATGGGTAACACACTCGAGTGTGTTACCCATCCATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-638s21c1
Sequence:CCGGTCTGGCTAACTGCAAGCTAAACTCGAGTTTAGCTTGCAGTTAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-893s1c1
Sequence:CCGGGCAAGATCATTGTAGATGAATCTCGAGATTCATCTACAATGATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-639s1c1
Sequence:CCGGTCTGGCTAACTGCAAGCTAAACTCGAGTTTAGCTTGCAGTTAGCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-477s1c1
Sequence:CCGGCCGAGACAAGACCATAAAGTTCTCGAGAACTTTATGGTCTTGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008143.2-307s1c1
Sequence:CCGGGATGTTGTTATCTCCTCTGATCTCGAGATCAGAGGAGATAACAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008143.2-1075s1c1
Sequence:CCGGGTCTTAGAAATAAACTGGCTTCTCGAGAAGCCAGTTTATTTCTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-296s1c1
Sequence:CCGGACTTCGTTAGTGATGTTGTTACTCGAGTAACAACATCACTAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-144s1c1
Sequence:CCGGCCACAATGGATGGGTAACACACTCGAGTGTGTTACCCATCCATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-991s1c1
Sequence:CCGGCAGACTCTGTTTGCTGGCTATCTCGAGATAGCCAGCAAACAGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-527s1c1
Sequence:CCGGCGGTCCAGGATGAGAGTCATTCTCGAGAATGACTCTCATCCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008143
VALIDATED
GNB2L1 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-526s21c1
Sequence:CCGGCGGTCCAGGATGAGAGTCATTCTCGAGAATGACTCTCATCCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-892s21c1
Sequence:CCGGGCAAGATCATTGTAGATGAATCTCGAGATTCATCTACAATGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-1074s21c1
Sequence:CCGGGTCTTAGAAATAAACTGGCTTCTCGAGAAGCCAGTTTATTTCTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-143s21c1
Sequence:CCGGCCACAATGGATGGGTAACACACTCGAGTGTGTTACCCATCCATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-638s21c1
Sequence:CCGGTCTGGCTAACTGCAAGCTAAACTCGAGTTTAGCTTGCAGTTAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-893s1c1
Sequence:CCGGGCAAGATCATTGTAGATGAATCTCGAGATTCATCTACAATGATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-639s1c1
Sequence:CCGGTCTGGCTAACTGCAAGCTAAACTCGAGTTTAGCTTGCAGTTAGCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-477s1c1
Sequence:CCGGCCGAGACAAGACCATAAAGTTCTCGAGAACTTTATGGTCTTGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008143.2-307s1c1
Sequence:CCGGGATGTTGTTATCTCCTCTGATCTCGAGATCAGAGGAGATAACAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008143.2-1075s1c1
Sequence:CCGGGTCTTAGAAATAAACTGGCTTCTCGAGAAGCCAGTTTATTTCTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-296s1c1
Sequence:CCGGACTTCGTTAGTGATGTTGTTACTCGAGTAACAACATCACTAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-144s1c1
Sequence:CCGGCCACAATGGATGGGTAACACACTCGAGTGTGTTACCCATCCATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-991s1c1
Sequence:CCGGCAGACTCTGTTTGCTGGCTATCTCGAGATAGCCAGCAAACAGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-527s1c1
Sequence:CCGGCGGTCCAGGATGAGAGTCATTCTCGAGAATGACTCTCATCCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008143
VALIDATED
GNB2L1 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-526s21c1
Sequence:CCGGCGGTCCAGGATGAGAGTCATTCTCGAGAATGACTCTCATCCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-892s21c1
Sequence:CCGGGCAAGATCATTGTAGATGAATCTCGAGATTCATCTACAATGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-1074s21c1
Sequence:CCGGGTCTTAGAAATAAACTGGCTTCTCGAGAAGCCAGTTTATTTCTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-143s21c1
Sequence:CCGGCCACAATGGATGGGTAACACACTCGAGTGTGTTACCCATCCATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008143.3-638s21c1
Sequence:CCGGTCTGGCTAACTGCAAGCTAAACTCGAGTTTAGCTTGCAGTTAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-893s1c1
Sequence:CCGGGCAAGATCATTGTAGATGAATCTCGAGATTCATCTACAATGATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-639s1c1
Sequence:CCGGTCTGGCTAACTGCAAGCTAAACTCGAGTTTAGCTTGCAGTTAGCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-477s1c1
Sequence:CCGGCCGAGACAAGACCATAAAGTTCTCGAGAACTTTATGGTCTTGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008143.2-307s1c1
Sequence:CCGGGATGTTGTTATCTCCTCTGATCTCGAGATCAGAGGAGATAACAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008143.2-1075s1c1
Sequence:CCGGGTCTTAGAAATAAACTGGCTTCTCGAGAAGCCAGTTTATTTCTAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-296s1c1
Sequence:CCGGACTTCGTTAGTGATGTTGTTACTCGAGTAACAACATCACTAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-144s1c1
Sequence:CCGGCCACAATGGATGGGTAACACACTCGAGTGTGTTACCCATCCATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-991s1c1
Sequence:CCGGCAGACTCTGTTTGCTGGCTATCTCGAGATAGCCAGCAAACAGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008143.2-527s1c1
Sequence:CCGGCGGTCCAGGATGAGAGTCATTCTCGAGAATGACTCTCATCCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006098
VALIDATED
GNB2L1 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-505s21c1
Sequence:CCGGTACCCTGGGTGTGTGCAAATACTCGAGTATTTGCACACACCCAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-741s21c1
Sequence:CCGGAGGATGGCCAGGCCATGTTATCTCGAGATAACATGGCCTGGCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-652s21c1
Sequence:CCGGCAAGCTGAAGACCAACCACATCTCGAGATGTGGTTGGTCTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-308s21c1
Sequence:CCGGGATGTGGTTATCTCCTCAGATCTCGAGATCTGAGGAGATAACCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-243s21c1
Sequence:CCGGCCAGGGATGAGACCAACTATGCTCGAGCATAGTTGGTCTCATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006098.2-866s1c1
Sequence:CCGGGATCTGGGATTTAGAGGGAAACTCGAGTTTCCCTCTAAATCCCAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006098.2-297s1c1
Sequence:CCGGGATGTGGTTATCTCCTCAGATCTCGAGATCTGAGGAGATAACCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006098.2-641s1c1
Sequence:CCGGCAAGCTGAAGACCAACCACATCTCGAGATGTGGTTGGTCTTCAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006098.2-200s1c1
Sequence:CCGGTCGAGATAAGACCATCATCATCTCGAGATGATGATGGTCTTATCTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006098
VALIDATED
GNB2L1 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-505s21c1
Sequence:CCGGTACCCTGGGTGTGTGCAAATACTCGAGTATTTGCACACACCCAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-741s21c1
Sequence:CCGGAGGATGGCCAGGCCATGTTATCTCGAGATAACATGGCCTGGCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-652s21c1
Sequence:CCGGCAAGCTGAAGACCAACCACATCTCGAGATGTGGTTGGTCTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-308s21c1
Sequence:CCGGGATGTGGTTATCTCCTCAGATCTCGAGATCTGAGGAGATAACCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-243s21c1
Sequence:CCGGCCAGGGATGAGACCAACTATGCTCGAGCATAGTTGGTCTCATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006098.2-866s1c1
Sequence:CCGGGATCTGGGATTTAGAGGGAAACTCGAGTTTCCCTCTAAATCCCAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006098.2-297s1c1
Sequence:CCGGGATGTGGTTATCTCCTCAGATCTCGAGATCTGAGGAGATAACCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006098.2-641s1c1
Sequence:CCGGCAAGCTGAAGACCAACCACATCTCGAGATGTGGTTGGTCTTCAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006098.2-200s1c1
Sequence:CCGGTCGAGATAAGACCATCATCATCTCGAGATGATGATGGTCTTATCTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006098
VALIDATED
GNB2L1 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-505s21c1
Sequence:CCGGTACCCTGGGTGTGTGCAAATACTCGAGTATTTGCACACACCCAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-741s21c1
Sequence:CCGGAGGATGGCCAGGCCATGTTATCTCGAGATAACATGGCCTGGCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-652s21c1
Sequence:CCGGCAAGCTGAAGACCAACCACATCTCGAGATGTGGTTGGTCTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-308s21c1
Sequence:CCGGGATGTGGTTATCTCCTCAGATCTCGAGATCTGAGGAGATAACCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006098.4-243s21c1
Sequence:CCGGCCAGGGATGAGACCAACTATGCTCGAGCATAGTTGGTCTCATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006098.2-866s1c1
Sequence:CCGGGATCTGGGATTTAGAGGGAAACTCGAGTTTCCCTCTAAATCCCAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006098.2-297s1c1
Sequence:CCGGGATGTGGTTATCTCCTCAGATCTCGAGATCTGAGGAGATAACCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006098.2-641s1c1
Sequence:CCGGCAAGCTGAAGACCAACCACATCTCGAGATGTGGTTGGTCTTCAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006098.2-200s1c1
Sequence:CCGGTCGAGATAAGACCATCATCATCTCGAGATGATGATGGTCTTATCTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks