EMAIL THIS PAGE TO A FRIEND

GNB3

guanine nucleotide binding protein (G protein), beta polypeptide 3

44 Gene Product Result for
UniProtKB ID: P16520, Q9BQC0
Gene ID:
Human(2784) Summary: Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. A single-nucleotide polymorphism (C825T) in this gene is associated with essential hypertension and obesity. This polymorphism is also associated with the occurrence of the splice variant GNB3-s, which appears to have increased activity. GNB3-s is an example of alternative splicing caused by a nucleotide change outside of the splice donor and acceptor sites. Additional splice variants may exist for this gene, but they have not been fully described. [provided by RefSeq, Jul 2008]
Mouse(14695) guanine nucleotide binding protein (G protein), beta 3
Rat(60449) guanine nucleotide binding protein (G protein), beta polypeptide 3
domestic guinea pig(100725705) guanine nucleotide binding protein (G protein), beta polypeptide 3
naked mole-rat(101718903) guanine nucleotide binding protein (G protein), beta polypeptide 3
sheep(101110493) guanine nucleotide binding protein (G protein), beta polypeptide 3
chicken(427945) guanine nucleotide binding protein (G protein), beta polypeptide 3
cow(513340) guanine nucleotide binding protein (G protein), beta polypeptide 3
dog(403511) guanine nucleotide binding protein (G protein), beta polypeptide 3
domestic cat(101084799) guanine nucleotide binding protein (G protein), beta polypeptide 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002075 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073811 MISSION® esiRNA esiRNA human GNB3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002075 Rosetta Predictions human pricing
NM_021858 Rosetta Predictions rat pricing
NM_013530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236731 predicted 780
2 SASI_Hs01_00236733 predicted 1649
3 SASI_Hs01_00236735 predicted 1077
4 SASI_Hs01_00236736 predicted 942
5 SASI_Hs01_00236737 predicted 1657
6 SASI_Hs01_00236738 predicted 1522
7 SASI_Hs01_00236739 predicted 1056
8 SASI_Hs01_00236740 predicted 634
9 SASI_Hs02_00333148 predicted 1698
10 SASI_Hs02_00333149 predicted 621
11 SASI_Hs01_00236732 predicted 1522
12 SASI_Hs01_00236734 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053760 predicted 369
2 SASI_Rn01_00053761 predicted 922
3 SASI_Rn01_00053762 predicted 900
4 SASI_Rn01_00053763 predicted 748
5 SASI_Rn01_00053764 predicted 302
6 SASI_Rn01_00053765 predicted 360
7 SASI_Rn01_00053766 predicted 384
8 SASI_Rn01_00053767 predicted 787
9 SASI_Rn01_00053768 predicted 1238
10 SASI_Rn01_00053769 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026634 predicted 1192
2 SASI_Mm01_00026635 predicted 641
3 SASI_Mm01_00026636 predicted 1418
4 SASI_Mm01_00026637 predicted 1028
5 SASI_Mm01_00026638 predicted 1177
6 SASI_Mm01_00026639 predicted 1033
7 SASI_Mm01_00026640 predicted 929
8 SASI_Mm01_00026641 predicted 653
9 SASI_Mm01_00026642 predicted 580
10 SASI_Mm01_00026643 predicted 625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002075
GNB3 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), beta polypeptide 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-766s1c1
Sequence:CCGGTGTTCCATCTACAACCTCAAACTCGAGTTTGAGGTTGTAGATGGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-985s1c1
Sequence:CCGGCCTGACTTCAATCTCTTCATTCTCGAGAATGAAGAGATTGAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-854s1c1
Sequence:CCGGGCTTCCTGGATGACAACAATACTCGAGTATTGTTGTCATCCAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-1251s1c1
Sequence:CCGGCCGCCTACTATTCGCTGGCTACTCGAGTAGCCAGCGAATAGTAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-445s1c1
Sequence:CCGGCTCAAGAAGCAGATTGCAGATCTCGAGATCTGCAATCTGCTTCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002075
GNB3 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), beta polypeptide 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-766s1c1
Sequence:CCGGTGTTCCATCTACAACCTCAAACTCGAGTTTGAGGTTGTAGATGGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-985s1c1
Sequence:CCGGCCTGACTTCAATCTCTTCATTCTCGAGAATGAAGAGATTGAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-854s1c1
Sequence:CCGGGCTTCCTGGATGACAACAATACTCGAGTATTGTTGTCATCCAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-1251s1c1
Sequence:CCGGCCGCCTACTATTCGCTGGCTACTCGAGTAGCCAGCGAATAGTAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-445s1c1
Sequence:CCGGCTCAAGAAGCAGATTGCAGATCTCGAGATCTGCAATCTGCTTCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002075
GNB3 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), beta polypeptide 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-766s1c1
Sequence:CCGGTGTTCCATCTACAACCTCAAACTCGAGTTTGAGGTTGTAGATGGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-985s1c1
Sequence:CCGGCCTGACTTCAATCTCTTCATTCTCGAGAATGAAGAGATTGAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-854s1c1
Sequence:CCGGGCTTCCTGGATGACAACAATACTCGAGTATTGTTGTCATCCAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-1251s1c1
Sequence:CCGGCCGCCTACTATTCGCTGGCTACTCGAGTAGCCAGCGAATAGTAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002075.2-445s1c1
Sequence:CCGGCTCAAGAAGCAGATTGCAGATCTCGAGATCTGCAATCTGCTTCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013530
GNB3 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), beta polypeptide 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013530.1-1504s1c1
Sequence:CCGGCCATTCCTAGTAAACTTCCTTCTCGAGAAGGAAGTTTACTAGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013530.1-435s1c1
Sequence:CCGGCAGATTGCTGATGCCAGGAAACTCGAGTTTCCTGGCATCAGCAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013530.1-746s1c1
Sequence:CCGGGTGTTCAATCTACAACCTCAACTCGAGTTGAGGTTGTAGATTGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013530.1-965s1c1
Sequence:CCGGCCCAGACTACAAACTCTTCATCTCGAGATGAAGAGTTTGTAGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013530.1-630s1c1
Sequence:CCGGTGGGACACTTATACCACCAATCTCGAGATTGGTGGTATAAGTGTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013530
GNB3 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), beta polypeptide 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013530.1-1504s1c1
Sequence:CCGGCCATTCCTAGTAAACTTCCTTCTCGAGAAGGAAGTTTACTAGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013530.1-435s1c1
Sequence:CCGGCAGATTGCTGATGCCAGGAAACTCGAGTTTCCTGGCATCAGCAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013530.1-746s1c1
Sequence:CCGGGTGTTCAATCTACAACCTCAACTCGAGTTGAGGTTGTAGATTGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013530.1-965s1c1
Sequence:CCGGCCCAGACTACAAACTCTTCATCTCGAGATGAAGAGTTTGTAGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013530.1-630s1c1
Sequence:CCGGTGGGACACTTATACCACCAATCTCGAGATTGGTGGTATAAGTGTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013530
GNB3 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), beta polypeptide 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013530.1-1504s1c1
Sequence:CCGGCCATTCCTAGTAAACTTCCTTCTCGAGAAGGAAGTTTACTAGGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013530.1-435s1c1
Sequence:CCGGCAGATTGCTGATGCCAGGAAACTCGAGTTTCCTGGCATCAGCAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013530.1-746s1c1
Sequence:CCGGGTGTTCAATCTACAACCTCAACTCGAGTTGAGGTTGTAGATTGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013530.1-965s1c1
Sequence:CCGGCCCAGACTACAAACTCTTCATCTCGAGATGAAGAGTTTGTAGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013530.1-630s1c1
Sequence:CCGGTGGGACACTTATACCACCAATCTCGAGATTGGTGGTATAAGTGTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)