EMAIL THIS PAGE TO A FRIEND

GNB4

guanine nucleotide binding protein (G protein), beta polypeptide 4

57 Gene Product Result for
Synonyms: CMTD1F
UniProtKB ID: Q9HAV0, B3KMH5, D3DNR8
Gene ID:
Human(59345) Summary: Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. [provided by RefSeq, Jul 2008]
Mouse(14696) guanine nucleotide binding protein (G protein), beta 4
Rat(294962) guanine nucleotide binding protein (G protein), beta polypeptide 4
chicken(424974) guanine nucleotide binding protein (G protein), beta polypeptide 4
dog(488087) guanine nucleotide binding protein (G protein), beta polypeptide 4
Horse(100058274) guanine nucleotide binding protein (G protein), beta polypeptide 4
cow(525962) guanine nucleotide binding protein (G protein), beta polypeptide 4
sheep(101108976) guanine nucleotide binding protein (G protein), beta polypeptide 4
Domestic Rabbit(100338332) guanine nucleotide binding protein (G protein), beta polypeptide 4
domestic guinea pig(100735635) guanine nucleotide binding protein (G protein), beta polypeptide 4
naked mole-rat(101714761) guanine nucleotide binding protein (G protein), beta polypeptide 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013531 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013531 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013531 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021629 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021629 Rosetta Predictions human pricing
NM_001013910 Rosetta Predictions rat pricing
NM_013531 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031974 predicted 306
2 SASI_Hs01_00031975 predicted 1093
3 SASI_Hs01_00031976 predicted 311
4 SASI_Hs01_00031977 predicted 531
5 SASI_Hs01_00031978 predicted 1139
6 SASI_Hs01_00031979 predicted 1051
7 SASI_Hs01_00031980 predicted 761
8 SASI_Hs01_00031981 predicted 588
9 SASI_Hs02_00354979 predicted 520
10 SASI_Hs01_00031982 predicted 774
11 SASI_Hs01_00031983 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069127 predicted 1193
2 SASI_Rn01_00069128 predicted 1013
3 SASI_Rn01_00069129 predicted 313
4 SASI_Rn02_00201197 predicted 766
5 SASI_Rn01_00069130 predicted 1011
6 SASI_Rn01_00069131 predicted 648
7 SASI_Rn01_00069132 predicted 729
8 SASI_Rn01_00069133 predicted 702
9 SASI_Rn01_00069134 predicted 535
10 SASI_Rn01_00069135 predicted 943
11 SASI_Rn01_00069136 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170546 predicted 947
2 SASI_Mm02_00322227 predicted 317
3 SASI_Mm01_00170547 predicted 760
4 SASI_Mm01_00170548 predicted 812
5 SASI_Mm01_00170549 predicted 376
6 SASI_Mm01_00170550 predicted 791
7 SASI_Mm01_00170551 predicted 220
8 SASI_Mm01_00170552 predicted 576
9 SASI_Mm01_00170554 predicted 949
10 SASI_Mm01_00170555 predicted 946
11 SASI_Mm01_00170553 predicted 571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013531
VALIDATED
GNB4 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), beta polypeptide 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013531.2-1302s1c1
Sequence:CCGGGCGTTCAATAAGCTGTAGTTTCTCGAGAAACTACAGCTTATTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013531.2-225s1c1
Sequence:CCGGGCTGGTTCAGATCACGTCTAACTCGAGTTAGACGTGATCTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013531.2-395s1c1
Sequence:CCGGCGACAAATAAGATGCACGCCACTCGAGTGGCGTGCATCTTATTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013531.2-260s1c1
Sequence:CCGGGCCGAATACAAATGCGAACAACTCGAGTTGTTCGCATTTGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013531.3-381s21c1
Sequence:CCGGGGGATAGCTATACGACAAATACTCGAGTATTTGTCGTATAGCTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013531.3-258s21c1
Sequence:CCGGGCCGAATACAAATGCGAACAACTCGAGTTGTTCGCATTTGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013531.3-223s21c1
Sequence:CCGGGCTGGTTCAGATCACGTCTAACTCGAGTTAGACGTGATCTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013531.3-1063s21c1
Sequence:CCGGTGGTCATGACAACCGTGTTAGCTCGAGCTAACACGGTTGTCATGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013531.3-1237s21c1
Sequence:CCGGCAACCCTCTACCTTCTATTTGCTCGAGCAAATAGAAGGTAGAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013531.3-921s21c1
Sequence:CCGGTGCTATACTCTCATGACAATACTCGAGTATTGTCATGAGAGTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013531
VALIDATED
GNB4 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), beta polypeptide 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013531.2-1302s1c1
Sequence:CCGGGCGTTCAATAAGCTGTAGTTTCTCGAGAAACTACAGCTTATTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013531.2-225s1c1
Sequence:CCGGGCTGGTTCAGATCACGTCTAACTCGAGTTAGACGTGATCTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013531.2-395s1c1
Sequence:CCGGCGACAAATAAGATGCACGCCACTCGAGTGGCGTGCATCTTATTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013531.2-260s1c1
Sequence:CCGGGCCGAATACAAATGCGAACAACTCGAGTTGTTCGCATTTGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013531.3-381s21c1
Sequence:CCGGGGGATAGCTATACGACAAATACTCGAGTATTTGTCGTATAGCTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013531.3-258s21c1
Sequence:CCGGGCCGAATACAAATGCGAACAACTCGAGTTGTTCGCATTTGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013531.3-223s21c1
Sequence:CCGGGCTGGTTCAGATCACGTCTAACTCGAGTTAGACGTGATCTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013531.3-1063s21c1
Sequence:CCGGTGGTCATGACAACCGTGTTAGCTCGAGCTAACACGGTTGTCATGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013531.3-1237s21c1
Sequence:CCGGCAACCCTCTACCTTCTATTTGCTCGAGCAAATAGAAGGTAGAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013531.3-921s21c1
Sequence:CCGGTGCTATACTCTCATGACAATACTCGAGTATTGTCATGAGAGTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013531
VALIDATED
GNB4 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), beta polypeptide 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013531.2-1302s1c1
Sequence:CCGGGCGTTCAATAAGCTGTAGTTTCTCGAGAAACTACAGCTTATTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013531.2-225s1c1
Sequence:CCGGGCTGGTTCAGATCACGTCTAACTCGAGTTAGACGTGATCTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013531.2-395s1c1
Sequence:CCGGCGACAAATAAGATGCACGCCACTCGAGTGGCGTGCATCTTATTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013531.2-260s1c1
Sequence:CCGGGCCGAATACAAATGCGAACAACTCGAGTTGTTCGCATTTGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013531.3-381s21c1
Sequence:CCGGGGGATAGCTATACGACAAATACTCGAGTATTTGTCGTATAGCTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013531.3-258s21c1
Sequence:CCGGGCCGAATACAAATGCGAACAACTCGAGTTGTTCGCATTTGTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013531.3-223s21c1
Sequence:CCGGGCTGGTTCAGATCACGTCTAACTCGAGTTAGACGTGATCTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013531.3-1063s21c1
Sequence:CCGGTGGTCATGACAACCGTGTTAGCTCGAGCTAACACGGTTGTCATGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013531.3-1237s21c1
Sequence:CCGGCAACCCTCTACCTTCTATTTGCTCGAGCAAATAGAAGGTAGAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013531.3-921s21c1
Sequence:CCGGTGCTATACTCTCATGACAATACTCGAGTATTGTCATGAGAGTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021629
VALIDATED
GNB4 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), beta polypeptide 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021629.2-402s1c1
Sequence:CCGGGTCGAATACAAATGCGAACAACTCGAGTTGTTCGCATTTGTATTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021629.2-1139s1c1
Sequence:CCGGGCTGGTTACGATGACTTTAATCTCGAGATTAAAGTCATCGTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021629.2-896s1c1
Sequence:CCGGGCCTCTTCCAAATTATGGGATCTCGAGATCCCATAATTTGGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021629.2-341s1c1
Sequence:CCGGGCTCGGAAAGCATGTAATGATCTCGAGATCATTACATGCTTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021629.2-1046s1c1
Sequence:CCGGCGTGCAGATCAAGAGTTATTACTCGAGTAATAACTCTTGATCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021629.3-1222s21c1
Sequence:CCGGTGTGAGCTGCTTAGGTGTAACCTCGAGGTTACACCTAAGCAGCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021629.3-594s21c1
Sequence:CCGCATGCTCCCTCTGGTAATTATGCTCGAGCATAATTACCAGAGGGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021629.3-524s21c1
Sequence:CCGGTGGGATAGCTATACAACAAATCTCGAGATTTGTTGTATAGCTATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021629
VALIDATED
GNB4 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), beta polypeptide 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021629.2-402s1c1
Sequence:CCGGGTCGAATACAAATGCGAACAACTCGAGTTGTTCGCATTTGTATTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021629.2-1139s1c1
Sequence:CCGGGCTGGTTACGATGACTTTAATCTCGAGATTAAAGTCATCGTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021629.2-896s1c1
Sequence:CCGGGCCTCTTCCAAATTATGGGATCTCGAGATCCCATAATTTGGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021629.2-341s1c1
Sequence:CCGGGCTCGGAAAGCATGTAATGATCTCGAGATCATTACATGCTTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021629.2-1046s1c1
Sequence:CCGGCGTGCAGATCAAGAGTTATTACTCGAGTAATAACTCTTGATCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021629.3-1222s21c1
Sequence:CCGGTGTGAGCTGCTTAGGTGTAACCTCGAGGTTACACCTAAGCAGCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021629.3-594s21c1
Sequence:CCGCATGCTCCCTCTGGTAATTATGCTCGAGCATAATTACCAGAGGGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021629.3-524s21c1
Sequence:CCGGTGGGATAGCTATACAACAAATCTCGAGATTTGTTGTATAGCTATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021629
VALIDATED
GNB4 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), beta polypeptide 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021629.2-402s1c1
Sequence:CCGGGTCGAATACAAATGCGAACAACTCGAGTTGTTCGCATTTGTATTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021629.2-1139s1c1
Sequence:CCGGGCTGGTTACGATGACTTTAATCTCGAGATTAAAGTCATCGTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021629.2-896s1c1
Sequence:CCGGGCCTCTTCCAAATTATGGGATCTCGAGATCCCATAATTTGGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021629.2-341s1c1
Sequence:CCGGGCTCGGAAAGCATGTAATGATCTCGAGATCATTACATGCTTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021629.2-1046s1c1
Sequence:CCGGCGTGCAGATCAAGAGTTATTACTCGAGTAATAACTCTTGATCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021629.3-1222s21c1
Sequence:CCGGTGTGAGCTGCTTAGGTGTAACCTCGAGGTTACACCTAAGCAGCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021629.3-594s21c1
Sequence:CCGCATGCTCCCTCTGGTAATTATGCTCGAGCATAATTACCAGAGGGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021629.3-524s21c1
Sequence:CCGGTGGGATAGCTATACAACAAATCTCGAGATTTGTTGTATAGCTATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks