EMAIL THIS PAGE TO A FRIEND

GNB5

guanine nucleotide binding protein (G protein), beta 5

98 Gene Product Result for
Synonyms: GB5
UniProtKB ID: O14775, Q9HAU9, Q9UFT3
Gene ID:
Human(10681) Summary: Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. Alternatively spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Jul 2008]
Mouse(14697) guanine nucleotide binding protein (G protein), beta 5
Rat(83579) guanine nucleotide binding protein (G protein), beta 5
chicken(415417) guanine nucleotide binding protein (G protein), beta 5
Horse(100146498) guanine nucleotide binding protein (G protein), beta 5
cow(535365) guanine nucleotide binding protein (G protein), beta 5
domestic cat(101081809) guanine nucleotide binding protein (G protein), beta 5
dog(608623) guanine nucleotide binding protein (G protein), beta 5
domestic guinea pig(100719049) guanine nucleotide binding protein (G protein), beta 5
naked mole-rat(101698655) guanine nucleotide binding protein (G protein), beta 5
sheep(101106267) guanine nucleotide binding protein (G protein), beta 5
Domestic Rabbit(100008941) guanine nucleotide binding protein (G protein), beta 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006578 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010313 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010313 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010313 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006578 Rosetta Predictions human pricing
NM_016194 Rosetta Predictions human pricing
NM_031770 Rosetta Predictions rat pricing
NM_010313 Rosetta Predictions mouse pricing
NM_138719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034620 predicted 1139
2 SASI_Hs01_00034621 predicted 1186
3 SASI_Hs01_00034622 predicted 1219
4 SASI_Hs02_00341868 predicted 1161
5 SASI_Hs01_00034623 predicted 893
6 SASI_Hs01_00034624 predicted 794
7 SASI_Hs01_00034625 predicted 1195
8 SASI_Hs01_00034626 predicted 1191
9 SASI_Hs01_00034627 predicted 1163
10 SASI_Hs01_00034628 predicted 1065
11 SASI_Hs01_00034629 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234478 predicted 1241
2 SASI_Hs01_00234479 predicted 1288
3 SASI_Hs01_00234480 predicted 1329
4 SASI_Hs02_00349023 predicted 1270
5 SASI_Hs01_00234481 predicted 994
6 SASI_Hs01_00234482 predicted 893
7 SASI_Hs01_00234483 predicted 1293
8 SASI_Hs01_00234484 predicted 1293
9 SASI_Hs01_00234485 predicted 1271
10 SASI_Hs01_00234486 predicted 1164
11 SASI_Hs01_00234487 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265198 predicted 384
2 SASI_Rn01_00087572 predicted 802
3 SASI_Rn02_00265199 predicted 299
4 SASI_Rn01_00087574 predicted 251
5 SASI_Rn02_00265200 predicted 353
6 SASI_Rn02_00265201 predicted 669
7 SASI_Rn01_00087575 predicted 396
8 SASI_Rn02_00265202 predicted 824
9 SASI_Rn02_00265203 predicted 355
10 SASI_Rn02_00265204 predicted 475
11 SASI_Rn01_00087569 predicted 1064
12 SASI_Rn01_00087570 predicted 1233
13 SASI_Rn01_00087571 predicted 903
14 SASI_Rn01_00087573 predicted 913
15 SASI_Rn01_00087576 predicted 934
16 SASI_Rn01_00087577 predicted 993
17 SASI_Rn01_00087578 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010313 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168935 predicted 542
2 SASI_Mm01_00168937 predicted 607
3 SASI_Mm02_00318299 predicted 831
4 SASI_Mm01_00168938 predicted 379
5 SASI_Mm01_00168939 predicted 483
6 SASI_Mm01_00168940 predicted 422
7 SASI_Mm01_00168941 predicted 925
8 SASI_Mm01_00168942 predicted 370
9 SASI_Mm01_00168943 predicted 509
10 SASI_Mm01_00168944 predicted 955
11 SASI_Mm01_00168936 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154337 predicted 283
2 SASI_Mm01_00154338 predicted 444
3 SASI_Mm01_00154340 predicted 514
4 SASI_Mm02_00339784 predicted 388
5 SASI_Mm01_00154341 predicted 324
6 SASI_Mm01_00154342 predicted 832
7 SASI_Mm02_00339785 predicted 272
8 SASI_Mm01_00154343 predicted 417
9 SASI_Mm01_00154344 predicted 862
10 SASI_Mm01_00154345 predicted 225
11 SASI_Mm01_00154339 predicted 387
12 SASI_Mm01_00154346 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006578
VALIDATED
GNB5 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), beta 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006578.3-918s21c1
Sequence:CCGGTCCAAAGAAAGCATCATATTTCTCGAGAAATATGATGCTTTCTTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006578.3-1283s21c1
Sequence:CCGGAGCGTCTCCAATATGACTATTCTCGAGAATAGTCATATTGGAGACGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006578.2-1108s1c1
Sequence:CCGGGCTCTGGATCATGGGATCATACTCGAGTATGATCCCATGATCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006578.2-700s1c1
Sequence:CCGGCCTCAGAAACTGGAAACACCTCTCGAGAGGTGTTTCCAGTTTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006578.2-290s1c1
Sequence:CCGGCATGGACTGGTGCAAAGATAACTCGAGTTATCTTTGCACCAGTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006578.2-1066s1c1
Sequence:CCGGGCGTTAGCACTCTACGAGTTTCTCGAGAAACTCGTAGAGTGCTAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006578.2-985s1c1
Sequence:CCGGCTGGATACAATGATTACACTACTCGAGTAGTGTAATCATTGTATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006578
VALIDATED
GNB5 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), beta 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006578.3-918s21c1
Sequence:CCGGTCCAAAGAAAGCATCATATTTCTCGAGAAATATGATGCTTTCTTTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006578.3-1283s21c1
Sequence:CCGGAGCGTCTCCAATATGACTATTCTCGAGAATAGTCATATTGGAGACGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006578.2-1108s1c1
Sequence:CCGGGCTCTGGATCATGGGATCATACTCGAGTATGATCCCATGATCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006578.2-700s1c1
Sequence:CCGGCCTCAGAAACTGGAAACACCTCTCGAGAGGTGTTTCCAGTTTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006578.2-290s1c1
Sequence:CCGGCATGGACTGGTGCAAAGATAACTCGAGTTATCTTTGCACCAGTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006578.2-1066s1c1
Sequence:CCGGGCGTTAGCACTCTACGAGTTTCTCGAGAAACTCGTAGAGTGCTAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006578.2-985s1c1
Sequence:CCGGCTGGATACAATGATTACACTACTCGAGTAGTGTAATCATTGTATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006578
VALIDATED
GNB5 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), beta 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006578.3-918s21c1
Sequence:CCGGTCCAAAGAAAGCATCATATTTCTCGAGAAATATGATGCTTTCTTTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006578.3-1283s21c1
Sequence:CCGGAGCGTCTCCAATATGACTATTCTCGAGAATAGTCATATTGGAGACGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006578.2-1108s1c1
Sequence:CCGGGCTCTGGATCATGGGATCATACTCGAGTATGATCCCATGATCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006578.2-700s1c1
Sequence:CCGGCCTCAGAAACTGGAAACACCTCTCGAGAGGTGTTTCCAGTTTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006578.2-290s1c1
Sequence:CCGGCATGGACTGGTGCAAAGATAACTCGAGTTATCTTTGCACCAGTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006578.2-1066s1c1
Sequence:CCGGGCGTTAGCACTCTACGAGTTTCTCGAGAAACTCGTAGAGTGCTAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006578.2-985s1c1
Sequence:CCGGCTGGATACAATGATTACACTACTCGAGTAGTGTAATCATTGTATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010313
VALIDATED
GNB5 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), beta 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010313.1-958s21c1
Sequence:CCGGTCCAAGGAGAGCATCATATTTCTCGAGAAATATGATGCTCTCCTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010313.1-488s21c1
Sequence:CCGGCTTGTGGTGGTCTGGATAATACTCGAGTATTATCCAGACCACCACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010313.1-512s21c1
Sequence:CCGGGCTCTGTGTATCCACTGACATCTCGAGATGTCAGTGGATACACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010313.1-841s21c1
Sequence:CCGGGAATCGGATGTCAACAGTGTTCTCGAGAACACTGTTGACATCCGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010313.1-553s21c1
Sequence:CCGGGCCGCCAAGAAGAAGTCTGTTCTCGAGAACAGACTTCTTCTTGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010313.1-512s1c1
Sequence:CCGGGCTCTGTGTATCCACTGACATCTCGAGATGTCAGTGGATACACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010313.1-50s1c1
Sequence:CCGGGCTTCAAACAAAGGGCCCTAACTCGAGTTAGGGCCCTTTGTTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010313.1-553s1c1
Sequence:CCGGGCCGCCAAGAAGAAGTCTGTTCTCGAGAACAGACTTCTTCTTGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010313.1-841s1c1
Sequence:CCGGGAATCGGATGTCAACAGTGTTCTCGAGAACACTGTTGACATCCGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010313.1-522s1c1
Sequence:CCGGTCCACTGACATTCGACAAGAACTCGAGTTCTTGTCGAATGTCAGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010313
VALIDATED
GNB5 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), beta 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010313.1-958s21c1
Sequence:CCGGTCCAAGGAGAGCATCATATTTCTCGAGAAATATGATGCTCTCCTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010313.1-488s21c1
Sequence:CCGGCTTGTGGTGGTCTGGATAATACTCGAGTATTATCCAGACCACCACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010313.1-512s21c1
Sequence:CCGGGCTCTGTGTATCCACTGACATCTCGAGATGTCAGTGGATACACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010313.1-841s21c1
Sequence:CCGGGAATCGGATGTCAACAGTGTTCTCGAGAACACTGTTGACATCCGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010313.1-553s21c1
Sequence:CCGGGCCGCCAAGAAGAAGTCTGTTCTCGAGAACAGACTTCTTCTTGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010313.1-512s1c1
Sequence:CCGGGCTCTGTGTATCCACTGACATCTCGAGATGTCAGTGGATACACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010313.1-50s1c1
Sequence:CCGGGCTTCAAACAAAGGGCCCTAACTCGAGTTAGGGCCCTTTGTTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010313.1-553s1c1
Sequence:CCGGGCCGCCAAGAAGAAGTCTGTTCTCGAGAACAGACTTCTTCTTGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010313.1-841s1c1
Sequence:CCGGGAATCGGATGTCAACAGTGTTCTCGAGAACACTGTTGACATCCGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010313.1-522s1c1
Sequence:CCGGTCCACTGACATTCGACAAGAACTCGAGTTCTTGTCGAATGTCAGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010313
VALIDATED
GNB5 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), beta 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010313.1-958s21c1
Sequence:CCGGTCCAAGGAGAGCATCATATTTCTCGAGAAATATGATGCTCTCCTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010313.1-488s21c1
Sequence:CCGGCTTGTGGTGGTCTGGATAATACTCGAGTATTATCCAGACCACCACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010313.1-512s21c1
Sequence:CCGGGCTCTGTGTATCCACTGACATCTCGAGATGTCAGTGGATACACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010313.1-841s21c1
Sequence:CCGGGAATCGGATGTCAACAGTGTTCTCGAGAACACTGTTGACATCCGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010313.1-553s21c1
Sequence:CCGGGCCGCCAAGAAGAAGTCTGTTCTCGAGAACAGACTTCTTCTTGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010313.1-512s1c1
Sequence:CCGGGCTCTGTGTATCCACTGACATCTCGAGATGTCAGTGGATACACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010313.1-50s1c1
Sequence:CCGGGCTTCAAACAAAGGGCCCTAACTCGAGTTAGGGCCCTTTGTTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010313.1-553s1c1
Sequence:CCGGGCCGCCAAGAAGAAGTCTGTTCTCGAGAACAGACTTCTTCTTGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010313.1-841s1c1
Sequence:CCGGGAATCGGATGTCAACAGTGTTCTCGAGAACACTGTTGACATCCGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010313.1-522s1c1
Sequence:CCGGTCCACTGACATTCGACAAGAACTCGAGTTCTTGTCGAATGTCAGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)