EMAIL THIS PAGE TO A FRIEND

GNE

glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase

69 Gene Product Result for
Synonyms: DMRV GLCNE IBM2 NM Uae1
Gene ID:
Human(10020) Summary: The protein encoded by this gene is a bifunctional enzyme that initiates and regulates the biosynthesis of N-acetylneuraminic acid (NeuAc), a precursor of sialic acids. It is a rate-limiting enzyme in the sialic acid biosynthetic pathway. Sialic acid modification of cell surface molecules is crucial for their function in many biologic processes, including cell adhesion and signal transduction. Differential sialylation of cell surface molecules is also implicated in the tumorigenicity and metastatic behavior of malignant cells. Mutations in this gene are associated with sialuria, autosomal recessive inclusion body myopathy, and Nonaka myopathy. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(50798) glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Rat(114711) glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Zebrafish(393857) glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
domestic cat(101098411) glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
cow(782201) glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Horse(100067216) glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
dog(481607) glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
chicken(427285) glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
sheep(101110735) glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Domestic Rabbit(100340455) glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
domestic guinea pig(100731383) glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
naked mole-rat(101705910) glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005476 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128227 Rosetta Predictions human pricing
NM_005476 Rosetta Predictions human pricing
NM_053765 Rosetta Predictions rat pricing
NM_015828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330986 predicted 739
2 SASI_Hs02_00330987 predicted 2412
3 SASI_Hs02_00330988 predicted 618
4 SASI_Hs02_00330989 predicted 2215
5 SASI_Hs02_00330990 predicted 1654
6 SASI_Hs02_00330991 predicted 338
7 SASI_Hs02_00330992 predicted 1374
8 SASI_Hs02_00330993 predicted 353
9 SASI_Hs02_00330994 predicted 1508
10 SASI_Hs02_00330995 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057879 predicted 674
2 SASI_Hs01_00057880 predicted 2353
3 SASI_Hs01_00057881 predicted 550
4 SASI_Hs01_00057882 predicted 2146
5 SASI_Hs01_00057883 predicted 1582
6 SASI_Hs01_00057884 predicted 271
7 SASI_Hs01_00057885 predicted 1307
8 SASI_Hs01_00057886 predicted 295
9 SASI_Hs01_00057887 predicted 1445
10 SASI_Hs01_00057888 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266551 predicted 1130
2 SASI_Rn02_00266552 predicted 1634
3 SASI_Rn01_00115337 predicted 1518
4 SASI_Rn01_00115338 predicted 2358
5 SASI_Rn01_00115339 predicted 1180
6 SASI_Rn01_00115340 predicted 1735
7 SASI_Rn01_00115341 predicted 647
8 SASI_Rn01_00115342 predicted 767
9 SASI_Rn01_00115343 predicted 2349
10 SASI_Rn01_00115345 predicted 1603
11 SASI_Rn01_00115336 predicted 1668
12 SASI_Rn01_00115344 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323247 predicted 1487
2 SASI_Mm02_00323248 predicted 955
3 SASI_Mm02_00323249 predicted 705
4 SASI_Mm02_00323250 predicted 1004
5 SASI_Mm02_00323251 predicted 625
6 SASI_Mm02_00323252 predicted 2177
7 SASI_Mm02_00323253 predicted 824
8 SASI_Mm02_00323254 predicted 1554
9 SASI_Mm02_00323255 predicted 1431
10 SASI_Mm02_00323256 predicted 585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005476
VALIDATED
GNE MISSION shRNA Bacterial Glycerol Stock
glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-958s1c1
Sequence:CCGGGCAGTTAAACACGTCCCATTTCTCGAGAAATGGGACGTGTTTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005476.3-1581s1c1
Sequence:CCGGGCTGCATTCAACCAAACTGATCTCGAGATCAGTTTGGTTGAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-2140s1c1
Sequence:CCGGGCCAGTCACTATATCCACATTCTCGAGAATGTGGATATAGTGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005476.3-204s1c1
Sequence:CCGGCCCGATCATGTTTGGCATTAACTCGAGTTAATGCCAAACATGATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-2362s1c1
Sequence:CCGGGATGACCGTTTCTTAACAATCCTCGAGGATTGTTAAGAAACGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-1188s1c1
Sequence:CCGGGTACCCTTGTTCAAAGATATACTCGAGTATATCTTTGAACAAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-3375s1c1
Sequence:CCGGCTGGTTATTGTTCAGACATTCCTCGAGGAATGTCTGAACAATAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-3533s1c1
Sequence:CCGGCTACCAAGTTTCATACCAAATCTCGAGATTTGGTATGAAACTTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-946s1c1
Sequence:CCGGCCCAACTTTCGTGCAGTTAAACTCGAGTTTAACTGCACGAAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-1464s21c1
Sequence:CCGGACGAACCTCCGAGTTGCAATACTCGAGTATTGCAACTCGGAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-2645s21c1
Sequence:CCGGTGCCAAAGCAGCTACAATAATCTCGAGATTATTGTAGCTGCTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005476.4-1277s21c1
Sequence:CCGGGTACCCTTGTTCAAAGATATACTCGAGTATATCTTTGAACAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-263s21c1
Sequence:CCGGTTGTAACCGTGCAGATTATTCCTCGAGGAATAATCTGCACGGTTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-1536s21c1
Sequence:CCGGACCTATGAAGAGAGGATTAATCTCGAGATTAATCCTCTCTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-294s21c1
Sequence:CCGGCCGATCATGTTTGGCATTAAACTCGAGTTTAATGCCAAACATGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005476
VALIDATED
GNE MISSION shRNA shRNA Plasmid DNA
glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-958s1c1
Sequence:CCGGGCAGTTAAACACGTCCCATTTCTCGAGAAATGGGACGTGTTTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005476.3-1581s1c1
Sequence:CCGGGCTGCATTCAACCAAACTGATCTCGAGATCAGTTTGGTTGAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-2140s1c1
Sequence:CCGGGCCAGTCACTATATCCACATTCTCGAGAATGTGGATATAGTGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005476.3-204s1c1
Sequence:CCGGCCCGATCATGTTTGGCATTAACTCGAGTTAATGCCAAACATGATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-2362s1c1
Sequence:CCGGGATGACCGTTTCTTAACAATCCTCGAGGATTGTTAAGAAACGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-1188s1c1
Sequence:CCGGGTACCCTTGTTCAAAGATATACTCGAGTATATCTTTGAACAAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-3375s1c1
Sequence:CCGGCTGGTTATTGTTCAGACATTCCTCGAGGAATGTCTGAACAATAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-3533s1c1
Sequence:CCGGCTACCAAGTTTCATACCAAATCTCGAGATTTGGTATGAAACTTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-946s1c1
Sequence:CCGGCCCAACTTTCGTGCAGTTAAACTCGAGTTTAACTGCACGAAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-1464s21c1
Sequence:CCGGACGAACCTCCGAGTTGCAATACTCGAGTATTGCAACTCGGAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-2645s21c1
Sequence:CCGGTGCCAAAGCAGCTACAATAATCTCGAGATTATTGTAGCTGCTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005476.4-1277s21c1
Sequence:CCGGGTACCCTTGTTCAAAGATATACTCGAGTATATCTTTGAACAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-263s21c1
Sequence:CCGGTTGTAACCGTGCAGATTATTCCTCGAGGAATAATCTGCACGGTTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-1536s21c1
Sequence:CCGGACCTATGAAGAGAGGATTAATCTCGAGATTAATCCTCTCTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-294s21c1
Sequence:CCGGCCGATCATGTTTGGCATTAAACTCGAGTTTAATGCCAAACATGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005476
VALIDATED
GNE MISSION shRNA Lentiviral Transduction Particles
glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-958s1c1
Sequence:CCGGGCAGTTAAACACGTCCCATTTCTCGAGAAATGGGACGTGTTTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005476.3-1581s1c1
Sequence:CCGGGCTGCATTCAACCAAACTGATCTCGAGATCAGTTTGGTTGAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-2140s1c1
Sequence:CCGGGCCAGTCACTATATCCACATTCTCGAGAATGTGGATATAGTGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005476.3-204s1c1
Sequence:CCGGCCCGATCATGTTTGGCATTAACTCGAGTTAATGCCAAACATGATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-2362s1c1
Sequence:CCGGGATGACCGTTTCTTAACAATCCTCGAGGATTGTTAAGAAACGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-1188s1c1
Sequence:CCGGGTACCCTTGTTCAAAGATATACTCGAGTATATCTTTGAACAAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-3375s1c1
Sequence:CCGGCTGGTTATTGTTCAGACATTCCTCGAGGAATGTCTGAACAATAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-3533s1c1
Sequence:CCGGCTACCAAGTTTCATACCAAATCTCGAGATTTGGTATGAAACTTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005476.3-946s1c1
Sequence:CCGGCCCAACTTTCGTGCAGTTAAACTCGAGTTTAACTGCACGAAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-1464s21c1
Sequence:CCGGACGAACCTCCGAGTTGCAATACTCGAGTATTGCAACTCGGAGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-2645s21c1
Sequence:CCGGTGCCAAAGCAGCTACAATAATCTCGAGATTATTGTAGCTGCTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005476.4-1277s21c1
Sequence:CCGGGTACCCTTGTTCAAAGATATACTCGAGTATATCTTTGAACAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-263s21c1
Sequence:CCGGTTGTAACCGTGCAGATTATTCCTCGAGGAATAATCTGCACGGTTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-1536s21c1
Sequence:CCGGACCTATGAAGAGAGGATTAATCTCGAGATTAATCCTCTCTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005476.4-294s21c1
Sequence:CCGGCCGATCATGTTTGGCATTAAACTCGAGTTTAATGCCAAACATGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015828
VALIDATED
GNE MISSION shRNA Bacterial Glycerol Stock
glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015828.2-1615s1c1
Sequence:CCGGGCTGCATTCAACCAAGCTGATCTCGAGATCAGCTTGGTTGAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015828.2-900s1c1
Sequence:CCGGCCCTAGTTCTGTTTCCAAATACTCGAGTATTTGGAAACAGAACTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015828.2-1482s1c1
Sequence:CCGGCCTATGAAGAAAGGATTAGTTCTCGAGAACTAATCCTTTCTTCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015828.2-577s1c1
Sequence:CCGGCGGGACCATTGATGACTCTATCTCGAGATAGAGTCATCAATGGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015828.3-121s21c1
Sequence:CCGGAGGACCTCATGAACTCTATTTCTCGAGAAATAGAGTTCATGAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015828.3-2805s21c1
Sequence:CCGGACTCGTGCAGCAGGCTTTAATCTCGAGATTAAAGCCTGCTGCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015828.2-1482s21c1
Sequence:CCGGCCTATGAAGAAAGGATTAGTTCTCGAGAACTAATCCTTTCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015828.2-872s21c1
Sequence:CCGGGATGCCCTGATCTCGTTTAACCTCGAGGTTAAACGAGATCAGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015828.2-900s21c1
Sequence:CCGGCCCTAGTTCTGTTTCCAAATACTCGAGTATTTGGAAACAGAACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015828.2-734s21c1
Sequence:CCGGGCCAAGAACAAAGACTATATGCTCGAGCATATAGTCTTTGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015828.2-2401s21c1
Sequence:CCGGGTTTCTGCGAAGGCAAATTTGCTCGAGCAAATTTGCCTTCGCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015828
VALIDATED
GNE MISSION shRNA shRNA Plasmid DNA
glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015828.2-1615s1c1
Sequence:CCGGGCTGCATTCAACCAAGCTGATCTCGAGATCAGCTTGGTTGAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015828.2-900s1c1
Sequence:CCGGCCCTAGTTCTGTTTCCAAATACTCGAGTATTTGGAAACAGAACTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015828.2-1482s1c1
Sequence:CCGGCCTATGAAGAAAGGATTAGTTCTCGAGAACTAATCCTTTCTTCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015828.2-577s1c1
Sequence:CCGGCGGGACCATTGATGACTCTATCTCGAGATAGAGTCATCAATGGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015828.3-121s21c1
Sequence:CCGGAGGACCTCATGAACTCTATTTCTCGAGAAATAGAGTTCATGAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015828.3-2805s21c1
Sequence:CCGGACTCGTGCAGCAGGCTTTAATCTCGAGATTAAAGCCTGCTGCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015828.2-1482s21c1
Sequence:CCGGCCTATGAAGAAAGGATTAGTTCTCGAGAACTAATCCTTTCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015828.2-872s21c1
Sequence:CCGGGATGCCCTGATCTCGTTTAACCTCGAGGTTAAACGAGATCAGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015828.2-900s21c1
Sequence:CCGGCCCTAGTTCTGTTTCCAAATACTCGAGTATTTGGAAACAGAACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015828.2-734s21c1
Sequence:CCGGGCCAAGAACAAAGACTATATGCTCGAGCATATAGTCTTTGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015828.2-2401s21c1
Sequence:CCGGGTTTCTGCGAAGGCAAATTTGCTCGAGCAAATTTGCCTTCGCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015828
VALIDATED
GNE MISSION shRNA Lentiviral Transduction Particles
glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015828.2-1615s1c1
Sequence:CCGGGCTGCATTCAACCAAGCTGATCTCGAGATCAGCTTGGTTGAATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015828.2-900s1c1
Sequence:CCGGCCCTAGTTCTGTTTCCAAATACTCGAGTATTTGGAAACAGAACTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015828.2-1482s1c1
Sequence:CCGGCCTATGAAGAAAGGATTAGTTCTCGAGAACTAATCCTTTCTTCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015828.2-577s1c1
Sequence:CCGGCGGGACCATTGATGACTCTATCTCGAGATAGAGTCATCAATGGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015828.3-121s21c1
Sequence:CCGGAGGACCTCATGAACTCTATTTCTCGAGAAATAGAGTTCATGAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015828.3-2805s21c1
Sequence:CCGGACTCGTGCAGCAGGCTTTAATCTCGAGATTAAAGCCTGCTGCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015828.2-1482s21c1
Sequence:CCGGCCTATGAAGAAAGGATTAGTTCTCGAGAACTAATCCTTTCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015828.2-872s21c1
Sequence:CCGGGATGCCCTGATCTCGTTTAACCTCGAGGTTAAACGAGATCAGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015828.2-900s21c1
Sequence:CCGGCCCTAGTTCTGTTTCCAAATACTCGAGTATTTGGAAACAGAACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015828.2-734s21c1
Sequence:CCGGGCCAAGAACAAAGACTATATGCTCGAGCATATAGTCTTTGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015828.2-2401s21c1
Sequence:CCGGGTTTCTGCGAAGGCAAATTTGCTCGAGCAAATTTGCCTTCGCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks