EMAIL THIS PAGE TO A FRIEND

GNG10

guanine nucleotide binding protein (G protein), gamma 10

73 Gene Product Result for
UniProtKB ID: P50151, Q3B7K2, Q4VC27
Gene ID:
Mouse(14700) guanine nucleotide binding protein (G protein), gamma 10
Rat(114119) guanine nucleotide binding protein (G protein), gamma 10
Domestic Rabbit(100534635) guanine nucleotide binding protein (G protein), gamma 10
Zebrafish(796780) guanine nucleotide binding protein (G protein), gamma 10
cow(613930) guanine nucleotide binding protein (G protein), gamma 10
dog(100534634) guanine nucleotide binding protein (G protein), gamma 10
chicken(769603) guanine nucleotide binding protein (G protein), gamma 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302709 ANTI-GNG10 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001017998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017998 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073991 MISSION® esiRNA esiRNA targeting mouse Gng10 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017998 Rosetta Predictions human pricing
NM_053660 Rosetta Predictions rat pricing
XM_578454 Rosetta Predictions rat pricing
NM_025277 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196491 predicted 755
2 SASI_Hs01_00196492 predicted 515
3 SASI_Hs01_00196493 predicted 547
4 SASI_Hs01_00196494 predicted 286
5 SASI_Hs01_00196495 predicted 433
6 SASI_Hs01_00196496 predicted 247
7 SASI_Hs01_00196497 predicted 664
8 SASI_Hs01_00196498 predicted 558
9 SASI_Hs01_00196499 predicted 590
10 SASI_Hs01_00196500 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066588 predicted 713
2 SASI_Rn01_00066595 predicted 618
3 SASI_Rn01_00066589 predicted 676
4 SASI_Rn01_00066590 predicted 497
5 SASI_Rn01_00066596 predicted 493
6 SASI_Rn01_00066592 predicted 584
7 SASI_Rn02_00266390 predicted 246
8 SASI_Rn02_00266391 predicted 456
9 SASI_Rn02_00266392 predicted 261
10 SASI_Rn02_00266393 predicted 620
11 SASI_Rn01_00066591 predicted 322
12 SASI_Rn01_00066593 predicted 270
13 SASI_Rn01_00066594 predicted 596
14 SASI_Rn01_00066597 predicted 143
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127891 predicted 163
2 SASI_Rn01_00127892 predicted 149
3 SASI_Rn01_00127893 predicted 61
4 SASI_Rn01_00127894 predicted 156
5 SASI_Rn01_00127895 predicted 203
6 SASI_Rn01_00127896 predicted 143
7 SASI_Rn01_00127897 predicted 194
8 SASI_Rn01_00127898 predicted 133
9 SASI_Rn01_00127899 predicted 62
10 SASI_Rn01_00127900 predicted 135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167006 predicted 652
2 SASI_Mm01_00167007 predicted 731
3 SASI_Mm01_00167008 predicted 439
4 SASI_Mm01_00167009 predicted 669
5 SASI_Mm01_00167011 predicted 364
6 SASI_Mm02_00327885 predicted 375
7 SASI_Mm01_00167012 predicted 262
8 SASI_Mm01_00167014 predicted 286
9 SASI_Mm01_00167015 predicted 318
10 SASI_Mm02_00327886 predicted 338
11 SASI_Mm01_00167010 predicted 557
12 SASI_Mm01_00167013 predicted 646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025277
VALIDATED
GNG10 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 10
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025277.3-266s21c1
Sequence:CCGGCCCAGGTCCTGTGCTCTACTTCTCGAGAAGTAGAGCACAGGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025277.3-282s21c1
Sequence:CCGGTACTTTGAAGACTGGGAAGAACTCGAGTTCTTCCCAGTCTTCAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025277.3-553s21c1
Sequence:CCGGCAGGACAGAAAGGTTGCATTTCTCGAGAAATGCAACCTTTCTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025277.3-182s21c1
Sequence:CCGGGAGCTTCAGCAGTACTGCATACTCGAGTATGCAGTACTGCTGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025277.3-196s21c1
Sequence:CCGGCTGCATACAGAATGCATGCAACTCGAGTTGCATGCATTCTGTATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-142s1c1
Sequence:CCGGGAGCTTCAGCAGTACTGCATACTCGAGTATGCAGTACTGCTGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-156s1c1
Sequence:CCGGCTGCATACAGAATGCATGCAACTCGAGTTGCATGCATTCTGTATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-226s1c1
Sequence:CCGGCCCAGGTCCTGTGCTCTACTTCTCGAGAAGTAGAGCACAGGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-105s1c1
Sequence:CCGGTGGCGTGGAGAGGATCAAGGTCTCGAGACCTTGATCCTCTCCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-165s1c1
Sequence:CCGGGAATGCATGCAAGGACGCCCTCTCGAGAGGGCGTCCTTGCATGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025277
VALIDATED
GNG10 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 10
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025277.3-266s21c1
Sequence:CCGGCCCAGGTCCTGTGCTCTACTTCTCGAGAAGTAGAGCACAGGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025277.3-282s21c1
Sequence:CCGGTACTTTGAAGACTGGGAAGAACTCGAGTTCTTCCCAGTCTTCAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025277.3-553s21c1
Sequence:CCGGCAGGACAGAAAGGTTGCATTTCTCGAGAAATGCAACCTTTCTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025277.3-182s21c1
Sequence:CCGGGAGCTTCAGCAGTACTGCATACTCGAGTATGCAGTACTGCTGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025277.3-196s21c1
Sequence:CCGGCTGCATACAGAATGCATGCAACTCGAGTTGCATGCATTCTGTATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-142s1c1
Sequence:CCGGGAGCTTCAGCAGTACTGCATACTCGAGTATGCAGTACTGCTGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-156s1c1
Sequence:CCGGCTGCATACAGAATGCATGCAACTCGAGTTGCATGCATTCTGTATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-226s1c1
Sequence:CCGGCCCAGGTCCTGTGCTCTACTTCTCGAGAAGTAGAGCACAGGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-105s1c1
Sequence:CCGGTGGCGTGGAGAGGATCAAGGTCTCGAGACCTTGATCCTCTCCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-165s1c1
Sequence:CCGGGAATGCATGCAAGGACGCCCTCTCGAGAGGGCGTCCTTGCATGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025277
VALIDATED
GNG10 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 10
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025277.3-266s21c1
Sequence:CCGGCCCAGGTCCTGTGCTCTACTTCTCGAGAAGTAGAGCACAGGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025277.3-282s21c1
Sequence:CCGGTACTTTGAAGACTGGGAAGAACTCGAGTTCTTCCCAGTCTTCAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025277.3-553s21c1
Sequence:CCGGCAGGACAGAAAGGTTGCATTTCTCGAGAAATGCAACCTTTCTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025277.3-182s21c1
Sequence:CCGGGAGCTTCAGCAGTACTGCATACTCGAGTATGCAGTACTGCTGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025277.3-196s21c1
Sequence:CCGGCTGCATACAGAATGCATGCAACTCGAGTTGCATGCATTCTGTATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-142s1c1
Sequence:CCGGGAGCTTCAGCAGTACTGCATACTCGAGTATGCAGTACTGCTGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-156s1c1
Sequence:CCGGCTGCATACAGAATGCATGCAACTCGAGTTGCATGCATTCTGTATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-226s1c1
Sequence:CCGGCCCAGGTCCTGTGCTCTACTTCTCGAGAAGTAGAGCACAGGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-105s1c1
Sequence:CCGGTGGCGTGGAGAGGATCAAGGTCTCGAGACCTTGATCCTCTCCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025277.1-165s1c1
Sequence:CCGGGAATGCATGCAAGGACGCCCTCTCGAGAGGGCGTCCTTGCATGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017998
VALIDATED
GNG10 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017998.2-152s21c1
Sequence:CCGGCAGAGCTTCAACAGTACTGTACTCGAGTACAGTACTGTTGAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017998.2-236s21c1
Sequence:CCGGAGCCTAGATCCTGTGCTTTACCTCGAGGTAAAGCACAGGATCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017998.2-677s21c1
Sequence:CCGGGTTGTTCCTGGAAGTTATTTACTCGAGTAAATAACTTCCAGGAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017998.2-91s21c1
Sequence:CCGGTTGGTAGAGCAGCTCAAGTTGCTCGAGCAACTTGAGCTGCTCTACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017998.2-121s21c1
Sequence:CCGGGTGGAGAGGATCAAGGTCTCTCTCGAGAGAGACCTTGATCCTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017998
VALIDATED
GNG10 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017998.2-152s21c1
Sequence:CCGGCAGAGCTTCAACAGTACTGTACTCGAGTACAGTACTGTTGAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017998.2-236s21c1
Sequence:CCGGAGCCTAGATCCTGTGCTTTACCTCGAGGTAAAGCACAGGATCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017998.2-677s21c1
Sequence:CCGGGTTGTTCCTGGAAGTTATTTACTCGAGTAAATAACTTCCAGGAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017998.2-91s21c1
Sequence:CCGGTTGGTAGAGCAGCTCAAGTTGCTCGAGCAACTTGAGCTGCTCTACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017998.2-121s21c1
Sequence:CCGGGTGGAGAGGATCAAGGTCTCTCTCGAGAGAGACCTTGATCCTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017998
VALIDATED
GNG10 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017998.2-152s21c1
Sequence:CCGGCAGAGCTTCAACAGTACTGTACTCGAGTACAGTACTGTTGAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017998.2-236s21c1
Sequence:CCGGAGCCTAGATCCTGTGCTTTACCTCGAGGTAAAGCACAGGATCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017998.2-677s21c1
Sequence:CCGGGTTGTTCCTGGAAGTTATTTACTCGAGTAAATAACTTCCAGGAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017998.2-91s21c1
Sequence:CCGGTTGGTAGAGCAGCTCAAGTTGCTCGAGCAACTTGAGCTGCTCTACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001017998.2-121s21c1
Sequence:CCGGGTGGAGAGGATCAAGGTCTCTCTCGAGAGAGACCTTGATCCTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks