EMAIL THIS PAGE TO A FRIEND

GNG11

guanine nucleotide binding protein (G protein), gamma 11

49 Gene Product Result for
Synonyms: GNGT11
UniProtKB ID: P61952, P50152
Gene ID:
Human(2791) Summary: This gene is a member of the guanine nucleotide-binding protein (G protein) gamma family and encodes a lipid-anchored, cell membrane protein. As a member of the heterotrimeric G protein complex, this protein plays a role in this transmembrane signaling system. This protein is also subject to carboxyl-terminal processing. Decreased expression of this gene is associated with splenic marginal zone lymphomas. [provided by RefSeq, Jul 2008]
Mouse(66066) guanine nucleotide binding protein (G protein), gamma 11
Rat(64199) guanine nucleotide binding protein (G protein), gamma 11
chicken(771999) guanine nucleotide binding protein (G protein), gamma 11
cow(511812) guanine nucleotide binding protein (G protein), gamma 11
domestic cat(101088915) guanine nucleotide binding protein (G protein), gamma 11
dog(610002) guanine nucleotide binding protein (G protein), gamma 11
domestic guinea pig(100734182) guanine nucleotide binding protein (G protein), gamma 11
naked mole-rat(101721082) guanine nucleotide binding protein (G protein), gamma 11
sheep(100192421) guanine nucleotide binding protein (G protein), gamma 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025331 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025331 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025331 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004126 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004126 Rosetta Predictions human pricing
NM_022396 Rosetta Predictions rat pricing
NM_025331 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216793 predicted 517
2 SASI_Hs01_00216794 predicted 576
3 SASI_Hs01_00216795 predicted 522
4 SASI_Hs01_00216796 predicted 522
5 SASI_Hs01_00216797 predicted 486
6 SASI_Hs01_00216799 predicted 554
7 SASI_Hs01_00216800 predicted 671
8 SASI_Hs02_00336977 predicted 634
9 SASI_Hs01_00216801 predicted 581
10 SASI_Hs01_00216802 predicted 658
11 SASI_Hs01_00216798 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064409 predicted 515
2 SASI_Rn01_00064410 predicted 451
3 SASI_Rn01_00064411 predicted 455
4 SASI_Rn01_00064412 predicted 531
5 SASI_Rn01_00064413 predicted 1020
6 SASI_Rn01_00064414 predicted 412
7 SASI_Rn01_00064415 predicted 457
8 SASI_Rn01_00064416 predicted 404
9 SASI_Rn01_00064417 predicted 414
10 SASI_Rn01_00064418 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162955 predicted 559
2 SASI_Mm01_00162956 predicted 416
3 SASI_Mm01_00162957 predicted 339
4 SASI_Mm02_00327984 predicted 531
5 SASI_Mm01_00162959 predicted 482
6 SASI_Mm01_00162960 predicted 504
7 SASI_Mm01_00162961 predicted 444
8 SASI_Mm01_00162963 predicted 431
9 SASI_Mm01_00162964 predicted 382
10 SASI_Mm02_00327985 predicted 471
11 SASI_Mm01_00162958 predicted 477
12 SASI_Mm01_00162962 predicted 434
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025331
VALIDATED
GNG11 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 11
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025331.2-402s1c1
Sequence:CCGGGAAGTCAAGTTGCAGAGACAACTCGAGTTGTCTCTGCAACTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025331.2-485s1c1
Sequence:CCGGTCTGGTAAAGGGAATCCCAGACTCGAGTCTGGGATTCCCTTTACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025331.2-413s1c1
Sequence:CCGGGCAGAGACAACAGGTATCTAACTCGAGTTAGATACCTGTTGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025331.2-381s1c1
Sequence:CCGGGAGGTTGAGCAACTTCGCAAACTCGAGTTTGCGAAGTTGCTCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025331.2-605s21c1
Sequence:CCGGAGCCAAAGTGTGTGTTGAAGACTCGAGTCTTCAACACACACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025331.2-536s21c1
Sequence:CCGGCTGTGTCATTTCATAAGTAACCTCGAGGTTACTTATGAAATGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025331.2-402s21c1
Sequence:CCGGGAAGTCAAGTTGCAGAGACAACTCGAGTTGTCTCTGCAACTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025331.2-413s21c1
Sequence:CCGGGCAGAGACAACAGGTATCTAACTCGAGTTAGATACCTGTTGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025331
VALIDATED
GNG11 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 11
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025331.2-402s1c1
Sequence:CCGGGAAGTCAAGTTGCAGAGACAACTCGAGTTGTCTCTGCAACTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025331.2-485s1c1
Sequence:CCGGTCTGGTAAAGGGAATCCCAGACTCGAGTCTGGGATTCCCTTTACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025331.2-413s1c1
Sequence:CCGGGCAGAGACAACAGGTATCTAACTCGAGTTAGATACCTGTTGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025331.2-381s1c1
Sequence:CCGGGAGGTTGAGCAACTTCGCAAACTCGAGTTTGCGAAGTTGCTCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025331.2-605s21c1
Sequence:CCGGAGCCAAAGTGTGTGTTGAAGACTCGAGTCTTCAACACACACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025331.2-536s21c1
Sequence:CCGGCTGTGTCATTTCATAAGTAACCTCGAGGTTACTTATGAAATGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025331.2-402s21c1
Sequence:CCGGGAAGTCAAGTTGCAGAGACAACTCGAGTTGTCTCTGCAACTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025331.2-413s21c1
Sequence:CCGGGCAGAGACAACAGGTATCTAACTCGAGTTAGATACCTGTTGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025331
VALIDATED
GNG11 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 11
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025331.2-402s1c1
Sequence:CCGGGAAGTCAAGTTGCAGAGACAACTCGAGTTGTCTCTGCAACTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025331.2-485s1c1
Sequence:CCGGTCTGGTAAAGGGAATCCCAGACTCGAGTCTGGGATTCCCTTTACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025331.2-413s1c1
Sequence:CCGGGCAGAGACAACAGGTATCTAACTCGAGTTAGATACCTGTTGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025331.2-381s1c1
Sequence:CCGGGAGGTTGAGCAACTTCGCAAACTCGAGTTTGCGAAGTTGCTCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025331.2-605s21c1
Sequence:CCGGAGCCAAAGTGTGTGTTGAAGACTCGAGTCTTCAACACACACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025331.2-536s21c1
Sequence:CCGGCTGTGTCATTTCATAAGTAACCTCGAGGTTACTTATGAAATGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025331.2-402s21c1
Sequence:CCGGGAAGTCAAGTTGCAGAGACAACTCGAGTTGTCTCTGCAACTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025331.2-413s21c1
Sequence:CCGGGCAGAGACAACAGGTATCTAACTCGAGTTAGATACCTGTTGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004126
VALIDATED
GNG11 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 11
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004126.2-552s1c1
Sequence:CCGGAGGCAGCTGTGTTATTTCATACTCGAGTATGAAATAACACAGCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004126.2-424s1c1
Sequence:CCGGGAAGTGAAGTTGCAGAGACAACTCGAGTTGTCTCTGCAACTTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004126.2-502s1c1
Sequence:CCGGGATCCTCTAGTAAAGGGAATTCTCGAGAATTCCCTTTACTAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004126.2-437s1c1
Sequence:CCGGAGAGACAACAAGTGTCTAAATCTCGAGATTTAGACACTTGTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004126.2-414s1c1
Sequence:CCGGGCTTCGCAAAGAAGTGAAGTTCTCGAGAACTTCACTTCTTTGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-572s21c1
Sequence:CCGGACGTTCTGGAGAGGATCCTCTCTCGAGAGAGGATCCTCTCCAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-774s21c1
Sequence:CCGGCACCATATAGATAGGGTTATGCTCGAGCATAACCCTATCTATATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-559s21c1
Sequence:CCGGACTATATTGAAGAACGTTCTGCTCGAGCAGAACGTTCTTCAATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004126.3-651s21c1
Sequence:CCGGTCATAAATAACTTGGGAGAAACTCGAGTTTCTCCCAAGTTATTTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-528s21c1
Sequence:CCGGCAAGTGTCTAAATGTTCTGAACTCGAGTTCAGAACATTTAGACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-763s21c1
Sequence:CCGGACTTTCTTAAGCACCATATAGCTCGAGCTATATGGTGCTTAAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-636s21c1
Sequence:CCGGGGCAGCTGTGTTATTTCATAACTCGAGTTATGAAATAACACAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004126.3-498s21c1
Sequence:CCGGCTTCGCAAAGAAGTGAAGTTGCTCGAGCAACTTCACTTCTTTGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004126
VALIDATED
GNG11 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 11
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004126.2-552s1c1
Sequence:CCGGAGGCAGCTGTGTTATTTCATACTCGAGTATGAAATAACACAGCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004126.2-424s1c1
Sequence:CCGGGAAGTGAAGTTGCAGAGACAACTCGAGTTGTCTCTGCAACTTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004126.2-502s1c1
Sequence:CCGGGATCCTCTAGTAAAGGGAATTCTCGAGAATTCCCTTTACTAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004126.2-437s1c1
Sequence:CCGGAGAGACAACAAGTGTCTAAATCTCGAGATTTAGACACTTGTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004126.2-414s1c1
Sequence:CCGGGCTTCGCAAAGAAGTGAAGTTCTCGAGAACTTCACTTCTTTGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-572s21c1
Sequence:CCGGACGTTCTGGAGAGGATCCTCTCTCGAGAGAGGATCCTCTCCAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-774s21c1
Sequence:CCGGCACCATATAGATAGGGTTATGCTCGAGCATAACCCTATCTATATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-559s21c1
Sequence:CCGGACTATATTGAAGAACGTTCTGCTCGAGCAGAACGTTCTTCAATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004126.3-651s21c1
Sequence:CCGGTCATAAATAACTTGGGAGAAACTCGAGTTTCTCCCAAGTTATTTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-528s21c1
Sequence:CCGGCAAGTGTCTAAATGTTCTGAACTCGAGTTCAGAACATTTAGACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-763s21c1
Sequence:CCGGACTTTCTTAAGCACCATATAGCTCGAGCTATATGGTGCTTAAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-636s21c1
Sequence:CCGGGGCAGCTGTGTTATTTCATAACTCGAGTTATGAAATAACACAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004126.3-498s21c1
Sequence:CCGGCTTCGCAAAGAAGTGAAGTTGCTCGAGCAACTTCACTTCTTTGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004126
VALIDATED
GNG11 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 11
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004126.2-552s1c1
Sequence:CCGGAGGCAGCTGTGTTATTTCATACTCGAGTATGAAATAACACAGCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004126.2-424s1c1
Sequence:CCGGGAAGTGAAGTTGCAGAGACAACTCGAGTTGTCTCTGCAACTTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004126.2-502s1c1
Sequence:CCGGGATCCTCTAGTAAAGGGAATTCTCGAGAATTCCCTTTACTAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004126.2-437s1c1
Sequence:CCGGAGAGACAACAAGTGTCTAAATCTCGAGATTTAGACACTTGTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004126.2-414s1c1
Sequence:CCGGGCTTCGCAAAGAAGTGAAGTTCTCGAGAACTTCACTTCTTTGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-572s21c1
Sequence:CCGGACGTTCTGGAGAGGATCCTCTCTCGAGAGAGGATCCTCTCCAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-774s21c1
Sequence:CCGGCACCATATAGATAGGGTTATGCTCGAGCATAACCCTATCTATATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-559s21c1
Sequence:CCGGACTATATTGAAGAACGTTCTGCTCGAGCAGAACGTTCTTCAATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004126.3-651s21c1
Sequence:CCGGTCATAAATAACTTGGGAGAAACTCGAGTTTCTCCCAAGTTATTTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-528s21c1
Sequence:CCGGCAAGTGTCTAAATGTTCTGAACTCGAGTTCAGAACATTTAGACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-763s21c1
Sequence:CCGGACTTTCTTAAGCACCATATAGCTCGAGCTATATGGTGCTTAAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004126.3-636s21c1
Sequence:CCGGGGCAGCTGTGTTATTTCATAACTCGAGTTATGAAATAACACAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004126.3-498s21c1
Sequence:CCGGCTTCGCAAAGAAGTGAAGTTGCTCGAGCAACTTCACTTCTTTGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks