EMAIL THIS PAGE TO A FRIEND

GNG12

guanine nucleotide binding protein (G protein), gamma 12

167 Gene Product Result for
UniProtKB ID: Q9UBI6, Q9BRV5
Gene ID:
Mouse(14701) guanine nucleotide binding protein (G protein), gamma 12
Rat(114120) guanine nucleotide binding protein (G protein), gamma 12
sheep(101115838) guanine nucleotide binding protein (G protein), gamma 12
domestic guinea pig(100719463) guanine nucleotide binding protein (G protein), gamma 12
naked mole-rat(101725110) guanine nucleotide binding protein (G protein), gamma 12
chicken(772239) guanine nucleotide binding protein (G protein), gamma 12
domestic cat(101089378) guanine nucleotide binding protein (G protein), gamma 12
cow(286850) guanine nucleotide binding protein (G protein), gamma 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025278 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025278 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025278 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018841 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143891 MISSION® esiRNA esiRNA human GNG12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018841 Rosetta Predictions human pricing
XM_001067408 Rosetta Predictions rat pricing
XM_578287 Rosetta Predictions rat pricing
NM_025278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083465 predicted 789
2 SASI_Hs01_00083466 predicted 401
3 SASI_Hs01_00083467 predicted 721
4 SASI_Hs01_00083468 predicted 788
5 SASI_Hs01_00083469 predicted 629
6 SASI_Hs01_00083470 predicted 719
7 SASI_Hs01_00083471 predicted 827
8 SASI_Hs01_00083472 predicted 395
9 SASI_Hs01_00083473 predicted 656
10 SASI_Hs02_00352295 predicted 240
11 SASI_Hs01_00083474 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320884 predicted 26
2 SASI_Rn02_00320885 predicted 139
3 SASI_Rn02_00320886 predicted 110
4 SASI_Rn02_00320887 predicted 101
5 SASI_Rn02_00320888 predicted 89
6 SASI_Rn02_00320889 predicted 182
7 SASI_Rn02_00320890 predicted 56
8 SASI_Rn02_00320891 predicted 179
9 SASI_Rn02_00320892 predicted 100
10 SASI_Rn02_00320893 predicted 138
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407774 predicted 25
2 SASI_Rn02_00407775 predicted 136
3 SASI_Rn02_00407776 predicted 108
4 SASI_Rn02_00407777 predicted 99
5 SASI_Rn02_00407778 predicted 97
6 SASI_Rn02_00407779 predicted 178
7 SASI_Rn02_00407780 predicted 60
8 SASI_Rn02_00407781 predicted 177
9 SASI_Rn02_00407782 predicted 102
10 SASI_Rn02_00407783 predicted 133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141414 predicted 498
2 SASI_Mm01_00141415 predicted 444
3 SASI_Mm01_00141416 predicted 319
4 SASI_Mm01_00141417 predicted 566
5 SASI_Mm01_00141418 predicted 465
6 SASI_Mm01_00141419 predicted 728
7 SASI_Mm01_00141420 predicted 391
8 SASI_Mm01_00141421 predicted 638
9 SASI_Mm01_00141422 predicted 474
10 SASI_Mm01_00141423 predicted 357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025278
VALIDATED
GNG12 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025278.4-269s21c1
Sequence:CCGGGCTGAGATTGGAAGCCTCCATCTCGAGATGGAGGCTTCCAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025278.4-407s21c1
Sequence:CCGGGAAGACCTGCATCATCTTATACTCGAGTATAAGATGATGCAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025278.4-394s21c1
Sequence:CCGGCGTTCAAGGATAAGAAGACCTCTCGAGAGGTCTTCTTATCCTTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025278.4-369s21c1
Sequence:CCGGATGGGCATACCGACCTCAGAACTCGAGTTCTGAGGTCGGTATGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025278.4-525s21c1
Sequence:CCGGACACCCTTCTCTCGGAATAATCTCGAGATTATTCCGAGAGAAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025278.2-315s1c1
Sequence:CCGGCGAAAGAATAAAGGTCTCAAACTCGAGTTTGAGACCTTTATTCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025278.2-419s1c1
Sequence:CCGGCGTTCAAGGATAAGAAGACCTCTCGAGAGGTCTTCTTATCCTTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025278.2-304s1c1
Sequence:CCGGGAAGCCTCCATCGAAAGAATACTCGAGTATTCTTTCGATGGAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025278.2-294s1c1
Sequence:CCGGGCTGAGATTGGAAGCCTCCATCTCGAGATGGAGGCTTCCAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025278
VALIDATED
GNG12 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025278.4-269s21c1
Sequence:CCGGGCTGAGATTGGAAGCCTCCATCTCGAGATGGAGGCTTCCAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025278.4-407s21c1
Sequence:CCGGGAAGACCTGCATCATCTTATACTCGAGTATAAGATGATGCAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025278.4-394s21c1
Sequence:CCGGCGTTCAAGGATAAGAAGACCTCTCGAGAGGTCTTCTTATCCTTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025278.4-369s21c1
Sequence:CCGGATGGGCATACCGACCTCAGAACTCGAGTTCTGAGGTCGGTATGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025278.4-525s21c1
Sequence:CCGGACACCCTTCTCTCGGAATAATCTCGAGATTATTCCGAGAGAAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025278.2-315s1c1
Sequence:CCGGCGAAAGAATAAAGGTCTCAAACTCGAGTTTGAGACCTTTATTCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025278.2-419s1c1
Sequence:CCGGCGTTCAAGGATAAGAAGACCTCTCGAGAGGTCTTCTTATCCTTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025278.2-304s1c1
Sequence:CCGGGAAGCCTCCATCGAAAGAATACTCGAGTATTCTTTCGATGGAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025278.2-294s1c1
Sequence:CCGGGCTGAGATTGGAAGCCTCCATCTCGAGATGGAGGCTTCCAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025278
VALIDATED
GNG12 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025278.4-269s21c1
Sequence:CCGGGCTGAGATTGGAAGCCTCCATCTCGAGATGGAGGCTTCCAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025278.4-407s21c1
Sequence:CCGGGAAGACCTGCATCATCTTATACTCGAGTATAAGATGATGCAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025278.4-394s21c1
Sequence:CCGGCGTTCAAGGATAAGAAGACCTCTCGAGAGGTCTTCTTATCCTTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025278.4-369s21c1
Sequence:CCGGATGGGCATACCGACCTCAGAACTCGAGTTCTGAGGTCGGTATGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025278.4-525s21c1
Sequence:CCGGACACCCTTCTCTCGGAATAATCTCGAGATTATTCCGAGAGAAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025278.2-315s1c1
Sequence:CCGGCGAAAGAATAAAGGTCTCAAACTCGAGTTTGAGACCTTTATTCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025278.2-419s1c1
Sequence:CCGGCGTTCAAGGATAAGAAGACCTCTCGAGAGGTCTTCTTATCCTTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025278.2-304s1c1
Sequence:CCGGGAAGCCTCCATCGAAAGAATACTCGAGTATTCTTTCGATGGAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025278.2-294s1c1
Sequence:CCGGGCTGAGATTGGAAGCCTCCATCTCGAGATGGAGGCTTCCAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018841
VALIDATED
GNG12 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 12
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-332s1c1
Sequence:CCGGGTGACCCTTTGCTGATAGGAACTCGAGTTCCTATCAGCAAAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018841.2-718s1c1
Sequence:CCGGCCGATATGTCAGGACCTAAATCTCGAGATTTAGGTCCTGACATATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018841.2-618s1c1
Sequence:CCGGCCACTTGGTAACTATGGCTTTCTCGAGAAAGCCATAGTTACCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-256s1c1
Sequence:CCGGGAAGCCTCCATTGAAGGAATACTCGAGTATTCCTTCAATGGAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-343s1c1
Sequence:CCGGCTGATAGGAATACCAACTTCACTCGAGTGAAGTTGGTATTCCTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018841.2-444s1c1
Sequence:CCGGGCAAATTATGAGCAGCTCCTTCTCGAGAAGGAGCTGCTCATAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-233s1c1
Sequence:CCGGGAACTGTGCAGCAGTTAAGATCTCGAGATCTTAACTGCTGCACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018841.2-1255s1c1
Sequence:CCGGGCTCATGTTCTCTACTGGATTCTCGAGAATCCAGTAGAGAACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-272s1c1
Sequence:CCGGGAATAAAGGTTTCGAAGGCATCTCGAGATGCCTTCGAAACCTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018841.2-345s1c1
Sequence:CCGGGATAGGAATACCAACTTCAGACTCGAGTCTGAAGTTGGTATTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018841.2-238s1c1
Sequence:CCGGGTGCAGCAGTTAAGATTAGAACTCGAGTTCTAATCTTAACTGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018841
VALIDATED
GNG12 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 12
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-332s1c1
Sequence:CCGGGTGACCCTTTGCTGATAGGAACTCGAGTTCCTATCAGCAAAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018841.2-718s1c1
Sequence:CCGGCCGATATGTCAGGACCTAAATCTCGAGATTTAGGTCCTGACATATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018841.2-618s1c1
Sequence:CCGGCCACTTGGTAACTATGGCTTTCTCGAGAAAGCCATAGTTACCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-256s1c1
Sequence:CCGGGAAGCCTCCATTGAAGGAATACTCGAGTATTCCTTCAATGGAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-343s1c1
Sequence:CCGGCTGATAGGAATACCAACTTCACTCGAGTGAAGTTGGTATTCCTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018841.2-444s1c1
Sequence:CCGGGCAAATTATGAGCAGCTCCTTCTCGAGAAGGAGCTGCTCATAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-233s1c1
Sequence:CCGGGAACTGTGCAGCAGTTAAGATCTCGAGATCTTAACTGCTGCACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018841.2-1255s1c1
Sequence:CCGGGCTCATGTTCTCTACTGGATTCTCGAGAATCCAGTAGAGAACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-272s1c1
Sequence:CCGGGAATAAAGGTTTCGAAGGCATCTCGAGATGCCTTCGAAACCTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018841.2-345s1c1
Sequence:CCGGGATAGGAATACCAACTTCAGACTCGAGTCTGAAGTTGGTATTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018841.2-238s1c1
Sequence:CCGGGTGCAGCAGTTAAGATTAGAACTCGAGTTCTAATCTTAACTGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018841
VALIDATED
GNG12 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 12
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-332s1c1
Sequence:CCGGGTGACCCTTTGCTGATAGGAACTCGAGTTCCTATCAGCAAAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018841.2-718s1c1
Sequence:CCGGCCGATATGTCAGGACCTAAATCTCGAGATTTAGGTCCTGACATATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018841.2-618s1c1
Sequence:CCGGCCACTTGGTAACTATGGCTTTCTCGAGAAAGCCATAGTTACCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-256s1c1
Sequence:CCGGGAAGCCTCCATTGAAGGAATACTCGAGTATTCCTTCAATGGAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-343s1c1
Sequence:CCGGCTGATAGGAATACCAACTTCACTCGAGTGAAGTTGGTATTCCTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018841.2-444s1c1
Sequence:CCGGGCAAATTATGAGCAGCTCCTTCTCGAGAAGGAGCTGCTCATAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-233s1c1
Sequence:CCGGGAACTGTGCAGCAGTTAAGATCTCGAGATCTTAACTGCTGCACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018841.2-1255s1c1
Sequence:CCGGGCTCATGTTCTCTACTGGATTCTCGAGAATCCAGTAGAGAACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018841.2-272s1c1
Sequence:CCGGGAATAAAGGTTTCGAAGGCATCTCGAGATGCCTTCGAAACCTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018841.2-345s1c1
Sequence:CCGGGATAGGAATACCAACTTCAGACTCGAGTCTGAAGTTGGTATTCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018841.2-238s1c1
Sequence:CCGGGTGCAGCAGTTAAGATTAGAACTCGAGTTCTAATCTTAACTGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks