EMAIL THIS PAGE TO A FRIEND

GNG13

guanine nucleotide binding protein (G protein), gamma 13

42 Gene Product Result for
Synonyms: G(gamma)13 h2-35
UniProtKB ID: Q9P2W3, B2R5C8, Q52LX0, Q9UJJ3
Gene ID:
Human(51764) Summary: Heterotrimeric G proteins, which consist of alpha (see MIM 139320), beta (see MIM 139380), and gamma subunits, function as signal transducers for the 7-transmembrane-helix G protein-coupled receptors. GNG13 is a gamma subunit that is expressed in taste, retinal, and neuronal tissues and plays a key role in taste transduction (Li et al., 2006 [PubMed 16473877]
Mouse(64337) guanine nucleotide binding protein (G protein), gamma 13
Rat(685451) guanine nucleotide binding protein (G protein), gamma 13
chicken(771014) guanine nucleotide binding protein (G protein), gamma 13
cow(517006) guanine nucleotide binding protein (G protein), gamma 13
domestic cat(101086526) guanine nucleotide binding protein (G protein), gamma 13
dog(611349) guanine nucleotide binding protein (G protein), gamma 13
domestic guinea pig(100718998) guanine nucleotide binding protein (G protein), gamma 13
naked mole-rat(101709292) guanine nucleotide binding protein (G protein), gamma 13
sheep(101112183) guanine nucleotide binding protein (G protein), gamma 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016541 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160631 MISSION® esiRNA esiRNA human GNG13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016541 Rosetta Predictions human pricing
XM_001063834 Rosetta Predictions rat pricing
NM_022422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018845 predicted 317
2 SASI_Hs01_00018846 predicted 264
3 SASI_Hs01_00018847 predicted 322
4 SASI_Hs01_00018848 predicted 486
5 SASI_Hs01_00018849 predicted 170
6 SASI_Hs01_00018851 predicted 487
7 SASI_Hs01_00018852 predicted 387
8 SASI_Hs02_00349643 predicted 127
9 SASI_Hs01_00018853 predicted 943
10 SASI_Hs02_00349644 predicted 938
11 SASI_Hs01_00018850 predicted 108
12 SASI_Hs01_00018854 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308447 predicted 300
2 SASI_Rn02_00308448 predicted 358
3 SASI_Rn02_00308449 predicted 334
4 SASI_Rn02_00308450 predicted 263
5 SASI_Rn02_00308451 predicted 307
6 SASI_Rn02_00308452 predicted 295
7 SASI_Rn02_00308453 predicted 368
8 SASI_Rn02_00308454 predicted 308
9 SASI_Rn02_00308455 predicted 293
10 SASI_Rn02_00308456 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156192 predicted 203
2 SASI_Mm01_00156193 predicted 236
3 SASI_Mm01_00156194 predicted 195
4 SASI_Mm01_00156195 predicted 182
5 SASI_Mm01_00156196 predicted 167
6 SASI_Mm01_00156197 predicted 230
7 SASI_Mm01_00156198 predicted 235
8 SASI_Mm01_00156199 predicted 236
9 SASI_Mm01_00156200 predicted 307
10 SASI_Mm01_00156191 predicted 170
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016541
GNG13 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016541.1-233s1c1
Sequence:CCGGACCTGATGAAGAACAACCCATCTCGAGATGGGTTGTTCTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016541.1-186s1c1
Sequence:CCGGGAAGTGGATCGAGGACGGGATCTCGAGATCCCGTCCTCGATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016541.1-242s1c1
Sequence:CCGGAGAACAACCCATGGGTGGAAACTCGAGTTTCCACCCATGGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016541.1-114s1c1
Sequence:CCGGAGAGGTGGAGAGCCTTAAGTACTCGAGTACTTAAGGCTCTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016541.2-284s21c1
Sequence:CCGGAGGGCAAATGCACCATCCTGTCTCGAGACAGGATGGTGCATTTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016541.2-132s21c1
Sequence:CCGGGAAAGAGGTGGAGAGCCTCAACTCGAGTTGAGGCTCTCCACCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016541.2-494s21c1
Sequence:CCGGCCACTCACTCCATCTTGTAAGCTCGAGCTTACAAGATGGAGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016541.2-738s21c1
Sequence:CCGGCCACTCACAACATCTTGTAAGCTCGAGCTTACAAGATGTTGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016541
GNG13 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016541.1-233s1c1
Sequence:CCGGACCTGATGAAGAACAACCCATCTCGAGATGGGTTGTTCTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016541.1-186s1c1
Sequence:CCGGGAAGTGGATCGAGGACGGGATCTCGAGATCCCGTCCTCGATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016541.1-242s1c1
Sequence:CCGGAGAACAACCCATGGGTGGAAACTCGAGTTTCCACCCATGGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016541.1-114s1c1
Sequence:CCGGAGAGGTGGAGAGCCTTAAGTACTCGAGTACTTAAGGCTCTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016541.2-284s21c1
Sequence:CCGGAGGGCAAATGCACCATCCTGTCTCGAGACAGGATGGTGCATTTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016541.2-132s21c1
Sequence:CCGGGAAAGAGGTGGAGAGCCTCAACTCGAGTTGAGGCTCTCCACCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016541.2-494s21c1
Sequence:CCGGCCACTCACTCCATCTTGTAAGCTCGAGCTTACAAGATGGAGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016541.2-738s21c1
Sequence:CCGGCCACTCACAACATCTTGTAAGCTCGAGCTTACAAGATGTTGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016541
GNG13 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016541.1-233s1c1
Sequence:CCGGACCTGATGAAGAACAACCCATCTCGAGATGGGTTGTTCTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016541.1-186s1c1
Sequence:CCGGGAAGTGGATCGAGGACGGGATCTCGAGATCCCGTCCTCGATCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016541.1-242s1c1
Sequence:CCGGAGAACAACCCATGGGTGGAAACTCGAGTTTCCACCCATGGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016541.1-114s1c1
Sequence:CCGGAGAGGTGGAGAGCCTTAAGTACTCGAGTACTTAAGGCTCTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016541.2-284s21c1
Sequence:CCGGAGGGCAAATGCACCATCCTGTCTCGAGACAGGATGGTGCATTTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016541.2-132s21c1
Sequence:CCGGGAAAGAGGTGGAGAGCCTCAACTCGAGTTGAGGCTCTCCACCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016541.2-494s21c1
Sequence:CCGGCCACTCACTCCATCTTGTAAGCTCGAGCTTACAAGATGGAGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016541.2-738s21c1
Sequence:CCGGCCACTCACAACATCTTGTAAGCTCGAGCTTACAAGATGTTGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022422
GNG13 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-183s1c1
Sequence:CCGGCCCGAGCTTCTCAAGTGGATTCTCGAGAATCCACTTGAGAAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-137s1c1
Sequence:CCGGCAAGTACCAACTGGCCTTCAACTCGAGTTGAAGGCCAGTTGGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-128s1c1
Sequence:CCGGAGAGAGCCTCAAGTACCAACTCTCGAGAGTTGGTACTTGAGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-188s1c1
Sequence:CCGGGCTTCTCAAGTGGATTGAGGACTCGAGTCCTCAATCCACTTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-194s1c1
Sequence:CCGGCAAGTGGATTGAGGATGGAATCTCGAGATTCCATCCTCAATCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022422
GNG13 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-183s1c1
Sequence:CCGGCCCGAGCTTCTCAAGTGGATTCTCGAGAATCCACTTGAGAAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-137s1c1
Sequence:CCGGCAAGTACCAACTGGCCTTCAACTCGAGTTGAAGGCCAGTTGGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-128s1c1
Sequence:CCGGAGAGAGCCTCAAGTACCAACTCTCGAGAGTTGGTACTTGAGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-188s1c1
Sequence:CCGGGCTTCTCAAGTGGATTGAGGACTCGAGTCCTCAATCCACTTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-194s1c1
Sequence:CCGGCAAGTGGATTGAGGATGGAATCTCGAGATTCCATCCTCAATCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022422
GNG13 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-183s1c1
Sequence:CCGGCCCGAGCTTCTCAAGTGGATTCTCGAGAATCCACTTGAGAAGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-137s1c1
Sequence:CCGGCAAGTACCAACTGGCCTTCAACTCGAGTTGAAGGCCAGTTGGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-128s1c1
Sequence:CCGGAGAGAGCCTCAAGTACCAACTCTCGAGAGTTGGTACTTGAGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-188s1c1
Sequence:CCGGGCTTCTCAAGTGGATTGAGGACTCGAGTCCTCAATCCACTTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022422.3-194s1c1
Sequence:CCGGCAAGTGGATTGAGGATGGAATCTCGAGATTCCATCCTCAATCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks