EMAIL THIS PAGE TO A FRIEND

GNG2

guanine nucleotide binding protein (G protein), gamma 2

UniProtKB ID: P59768, Q5JPE2, Q6P9A9
Gene ID:
Human(54331) Summary: This gene encodes one of the gamma subunits of a guanine nucleotide-binding protein. Such proteins are involved in signaling mechanisms across membranes. Various subunits forms heterodimers which then interact with the different signal molecules. [provided by RefSeq, Aug 2011]
Mouse(14702) guanine nucleotide binding protein (G protein), gamma 2
Rat(80850) guanine nucleotide binding protein (G protein), gamma 2
Zebrafish(550256) guanine nucleotide binding protein (G protein), gamma 2
chicken(423581) guanine nucleotide binding protein (G protein), gamma 2
domestic cat(101097491) guanine nucleotide binding protein (G protein), gamma 2
cow(281203) guanine nucleotide binding protein (G protein), gamma 2
dog(610817) guanine nucleotide binding protein (G protein), gamma 2
sheep(101106689) guanine nucleotide binding protein (G protein), gamma 2
domestic guinea pig(100731111) guanine nucleotide binding protein (G protein), gamma 2
naked mole-rat(101719408) guanine nucleotide binding protein (G protein), gamma 2
276 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010315 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010315 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010315 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053064 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053064 Rosetta Predictions human pricing
NM_001038637 Rosetta Predictions mouse pricing
NM_010315 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022064 predicted 1157
2 SASI_Hs01_00022065 predicted 1162
3 SASI_Hs01_00022066 predicted 843
4 SASI_Hs01_00022068 predicted 1076
5 SASI_Hs01_00022069 predicted 849
6 SASI_Hs01_00022070 predicted 590
7 SASI_Hs01_00022071 predicted 1171
8 SASI_Hs01_00022072 predicted 595
9 SASI_Hs01_00022073 predicted 1126
10 SASI_Hs02_00361903 predicted 580
11 SASI_Hs01_00022067 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289639 predicted 495
2 SASI_Mm02_00289640 predicted 472
3 SASI_Mm02_00289641 predicted 761
4 SASI_Mm02_00289642 predicted 774
5 SASI_Mm02_00289643 predicted 667
6 SASI_Mm02_00289644 predicted 213
7 SASI_Mm02_00289645 predicted 522
8 SASI_Mm02_00289646 predicted 546
9 SASI_Mm02_00289647 predicted 599
10 SASI_Mm02_00289648 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318310 predicted 906
2 SASI_Mm02_00318311 predicted 647
3 SASI_Mm02_00318312 predicted 928
4 SASI_Mm02_00318313 predicted 816
5 SASI_Mm02_00318314 predicted 619
6 SASI_Mm02_00318315 predicted 689
7 SASI_Mm02_00318316 predicted 749
8 SASI_Mm02_00318317 predicted 931
9 SASI_Mm02_00318318 predicted 613
10 SASI_Mm02_00318319 predicted 918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010315
VALIDATED
GNG2 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010315.4-465s21c1
Sequence:CCGGGCTGACTTGATGGCCTACTGTCTCGAGACAGTAGGCCATCAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010315.4-496s21c1
Sequence:CCGGCCAAGGAAGACCCTCTGCTGACTCGAGTCAGCAGAGGGTCTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010315.4-403s21c1
Sequence:CCGGAGCTGGTAGAACAGCTGAAGACTCGAGTCTTCAGCTGTTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010315.4-437s21c1
Sequence:CCGGCGACAGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010315.2-227s1c1
Sequence:CCGGCGACAGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010315.2-255s1c1
Sequence:CCGGGCTGACTTGATGGCCTACTGTCTCGAGACAGTAGGCCATCAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010315.2-286s1c1
Sequence:CCGGCCAAGGAAGACCCTCTGCTGACTCGAGTCAGCAGAGGGTCTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010315.2-183s1c1
Sequence:CCGGCAAGCCAGGAAGCTGGTAGAACTCGAGTTCTACCAGCTTCCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010315.2-193s1c1
Sequence:CCGGAGCTGGTAGAACAGCTGAAGACTCGAGTCTTCAGCTGTTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010315
VALIDATED
GNG2 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010315.4-465s21c1
Sequence:CCGGGCTGACTTGATGGCCTACTGTCTCGAGACAGTAGGCCATCAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010315.4-496s21c1
Sequence:CCGGCCAAGGAAGACCCTCTGCTGACTCGAGTCAGCAGAGGGTCTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010315.4-403s21c1
Sequence:CCGGAGCTGGTAGAACAGCTGAAGACTCGAGTCTTCAGCTGTTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010315.4-437s21c1
Sequence:CCGGCGACAGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010315.2-227s1c1
Sequence:CCGGCGACAGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010315.2-255s1c1
Sequence:CCGGGCTGACTTGATGGCCTACTGTCTCGAGACAGTAGGCCATCAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010315.2-286s1c1
Sequence:CCGGCCAAGGAAGACCCTCTGCTGACTCGAGTCAGCAGAGGGTCTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010315.2-183s1c1
Sequence:CCGGCAAGCCAGGAAGCTGGTAGAACTCGAGTTCTACCAGCTTCCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010315.2-193s1c1
Sequence:CCGGAGCTGGTAGAACAGCTGAAGACTCGAGTCTTCAGCTGTTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010315
VALIDATED
GNG2 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010315.4-465s21c1
Sequence:CCGGGCTGACTTGATGGCCTACTGTCTCGAGACAGTAGGCCATCAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010315.4-496s21c1
Sequence:CCGGCCAAGGAAGACCCTCTGCTGACTCGAGTCAGCAGAGGGTCTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010315.4-403s21c1
Sequence:CCGGAGCTGGTAGAACAGCTGAAGACTCGAGTCTTCAGCTGTTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010315.4-437s21c1
Sequence:CCGGCGACAGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010315.2-227s1c1
Sequence:CCGGCGACAGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010315.2-255s1c1
Sequence:CCGGGCTGACTTGATGGCCTACTGTCTCGAGACAGTAGGCCATCAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010315.2-286s1c1
Sequence:CCGGCCAAGGAAGACCCTCTGCTGACTCGAGTCAGCAGAGGGTCTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010315.2-183s1c1
Sequence:CCGGCAAGCCAGGAAGCTGGTAGAACTCGAGTTCTACCAGCTTCCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010315.2-193s1c1
Sequence:CCGGAGCTGGTAGAACAGCTGAAGACTCGAGTCTTCAGCTGTTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053064
VALIDATED
GNG2 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-1237s1c1
Sequence:CCGGCCTCCTAGTTAATAGTGGTATCTCGAGATACCACTATTAACTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-170s1c1
Sequence:CCGGCGACAGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-483s1c1
Sequence:CCGGCCGATCCACATCCTGACTTAACTCGAGTTAAGTCAGGATGTGGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053064.2-212s1c1
Sequence:CCGGCTACTGTGAAGCACATGCCAACTCGAGTTGGCATGTGCTTCACAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053064.2-134s1c1
Sequence:CCGGGAAGCTGGTAGAGCAGCTTAACTCGAGTTAAGCTGCTCTACCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053064.2-146s1c1
Sequence:CCGGGCAGCTTAAGATGGAAGCCAACTCGAGTTGGCTTCCATCTTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053064.2-147s1c1
Sequence:CCGGCAGCTTAAGATGGAAGCCAATCTCGAGATTGGCTTCCATCTTAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-273s1c1
Sequence:CCGGCCGTTTAGGGAGAAGAAGTTTCTCGAGAAACTTCTTCTCCCTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-159s1c1
Sequence:CCGGGAAGCCAATATCGACAGGATACTCGAGTATCCTGTCGATATTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053064.2-201s1c1
Sequence:CCGGGATTTGATGGCCTACTGTGAACTCGAGTTCACAGTAGGCCATCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053064.2-164s1c1
Sequence:CCGGCAATATCGACAGGATAAAGGTCTCGAGACCTTTATCCTGTCGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053064.2-149s1c1
Sequence:CCGGGCTTAAGATGGAAGCCAATATCTCGAGATATTGGCTTCCATCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053064
VALIDATED
GNG2 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-1237s1c1
Sequence:CCGGCCTCCTAGTTAATAGTGGTATCTCGAGATACCACTATTAACTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-170s1c1
Sequence:CCGGCGACAGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-483s1c1
Sequence:CCGGCCGATCCACATCCTGACTTAACTCGAGTTAAGTCAGGATGTGGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053064.2-212s1c1
Sequence:CCGGCTACTGTGAAGCACATGCCAACTCGAGTTGGCATGTGCTTCACAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053064.2-134s1c1
Sequence:CCGGGAAGCTGGTAGAGCAGCTTAACTCGAGTTAAGCTGCTCTACCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053064.2-146s1c1
Sequence:CCGGGCAGCTTAAGATGGAAGCCAACTCGAGTTGGCTTCCATCTTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053064.2-147s1c1
Sequence:CCGGCAGCTTAAGATGGAAGCCAATCTCGAGATTGGCTTCCATCTTAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-273s1c1
Sequence:CCGGCCGTTTAGGGAGAAGAAGTTTCTCGAGAAACTTCTTCTCCCTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-159s1c1
Sequence:CCGGGAAGCCAATATCGACAGGATACTCGAGTATCCTGTCGATATTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053064.2-201s1c1
Sequence:CCGGGATTTGATGGCCTACTGTGAACTCGAGTTCACAGTAGGCCATCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053064.2-164s1c1
Sequence:CCGGCAATATCGACAGGATAAAGGTCTCGAGACCTTTATCCTGTCGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053064.2-149s1c1
Sequence:CCGGGCTTAAGATGGAAGCCAATATCTCGAGATATTGGCTTCCATCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053064
VALIDATED
GNG2 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-1237s1c1
Sequence:CCGGCCTCCTAGTTAATAGTGGTATCTCGAGATACCACTATTAACTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-170s1c1
Sequence:CCGGCGACAGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-483s1c1
Sequence:CCGGCCGATCCACATCCTGACTTAACTCGAGTTAAGTCAGGATGTGGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053064.2-212s1c1
Sequence:CCGGCTACTGTGAAGCACATGCCAACTCGAGTTGGCATGTGCTTCACAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053064.2-134s1c1
Sequence:CCGGGAAGCTGGTAGAGCAGCTTAACTCGAGTTAAGCTGCTCTACCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053064.2-146s1c1
Sequence:CCGGGCAGCTTAAGATGGAAGCCAACTCGAGTTGGCTTCCATCTTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053064.2-147s1c1
Sequence:CCGGCAGCTTAAGATGGAAGCCAATCTCGAGATTGGCTTCCATCTTAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-273s1c1
Sequence:CCGGCCGTTTAGGGAGAAGAAGTTTCTCGAGAAACTTCTTCTCCCTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053064.2-159s1c1
Sequence:CCGGGAAGCCAATATCGACAGGATACTCGAGTATCCTGTCGATATTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053064.2-201s1c1
Sequence:CCGGGATTTGATGGCCTACTGTGAACTCGAGTTCACAGTAGGCCATCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053064.2-164s1c1
Sequence:CCGGCAATATCGACAGGATAAAGGTCTCGAGACCTTTATCCTGTCGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053064.2-149s1c1
Sequence:CCGGGCTTAAGATGGAAGCCAATATCTCGAGATATTGGCTTCCATCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks