EMAIL THIS PAGE TO A FRIEND

GNG3

guanine nucleotide binding protein (G protein), gamma 3

63 Gene Product Result for
UniProtKB ID: P63215, B2R4S7, P29798, Q61014
Gene ID:
Human(2785) Summary: Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The gamma subunit determines the specificity of which signaling pathways will be affected by this particular complex. The protein encoded by this gene represents the gamma subunit of both inhibitory and stimulatory complexes. [provided by RefSeq, Jan 2012]
Mouse(14704) guanine nucleotide binding protein (G protein), gamma 3
Rat(114117) guanine nucleotide binding protein (G protein), gamma 3
sheep(101114066) guanine nucleotide binding protein (G protein), gamma 3
domestic guinea pig(100730267) guanine nucleotide binding protein (G protein), gamma 3
naked mole-rat(101726057) guanine nucleotide binding protein (G protein), gamma 3
Zebrafish(114462) guanine nucleotide binding protein (G protein), gamma 3
cow(281204) guanine nucleotide binding protein (G protein), gamma 3
domestic cat(101091560) guanine nucleotide binding protein (G protein), gamma 3
dog(483783) guanine nucleotide binding protein (G protein), gamma 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0002785M1 Monoclonal Anti-GNG3 antibody produced in mouse clone 1E10-1B5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010316 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010316 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010316 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012202 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU072811 MISSION® esiRNA esiRNA targeting mouse Gng3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012202 Rosetta Predictions human pricing
XM_001073457 Rosetta Predictions rat pricing
XM_001074064 Rosetta Predictions rat pricing
NM_010316 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177161 predicted 369
2 SASI_Hs01_00177162 predicted 596
3 SASI_Hs01_00177163 predicted 299
4 SASI_Hs01_00177165 predicted 265
5 SASI_Hs02_00343854 predicted 331
6 SASI_Hs01_00177166 predicted 264
7 SASI_Hs01_00177167 predicted 596
8 SASI_Hs01_00177168 predicted 307
9 SASI_Hs01_00177169 predicted 596
10 SASI_Hs01_00177170 predicted 277
11 SASI_Hs01_00177164 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342926 predicted 503
2 SASI_Rn02_00342927 predicted 309
3 SASI_Rn02_00342928 predicted 387
4 SASI_Rn02_00342929 predicted 648
5 SASI_Rn02_00342930 predicted 330
6 SASI_Rn02_00342931 predicted 633
7 SASI_Rn02_00342932 predicted 394
8 SASI_Rn02_00342933 predicted 441
9 SASI_Rn02_00342934 predicted 520
10 SASI_Rn02_00342935 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344937 predicted 502
2 SASI_Rn02_00344938 predicted 316
3 SASI_Rn02_00344939 predicted 391
4 SASI_Rn02_00344940 predicted 645
5 SASI_Rn02_00344941 predicted 329
6 SASI_Rn02_00344942 predicted 639
7 SASI_Rn02_00344943 predicted 395
8 SASI_Rn02_00344944 predicted 439
9 SASI_Rn02_00344945 predicted 520
10 SASI_Rn02_00344946 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010316 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197260 predicted 655
2 SASI_Mm01_00197263 predicted 645
3 SASI_Mm01_00197266 predicted 900
4 SASI_Mm01_00197269 predicted 274
5 SASI_Mm02_00318320 predicted 914
6 SASI_Mm02_00318321 predicted 834
7 SASI_Mm01_00197261 predicted 301
8 SASI_Mm01_00197262 predicted 762
9 SASI_Mm01_00197264 predicted 559
10 SASI_Mm01_00197265 predicted 565
11 SASI_Mm01_00197267 predicted 637
12 SASI_Mm01_00197268 predicted 701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010316
GNG3 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-271s1c1
Sequence:CCGGGCTTAAGATTGAGGCCAGCTTCTCGAGAAGCTGGCCTCAATCTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-411s1c1
Sequence:CCGGAGTTCTTCTGTGCGCTCCTCTCTCGAGAGAGGAGCGCACAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-233s1c1
Sequence:CCGGACTATGAGTATTGGTCAAGCACTCGAGTGCTTGACCAATACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-328s1c1
Sequence:CCGGGATGACATACTGTGATGCCCACTCGAGTGGGCATCACAGTATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-292s1c1
Sequence:CCGGGTGCCGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010316
GNG3 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-271s1c1
Sequence:CCGGGCTTAAGATTGAGGCCAGCTTCTCGAGAAGCTGGCCTCAATCTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-411s1c1
Sequence:CCGGAGTTCTTCTGTGCGCTCCTCTCTCGAGAGAGGAGCGCACAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-233s1c1
Sequence:CCGGACTATGAGTATTGGTCAAGCACTCGAGTGCTTGACCAATACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-328s1c1
Sequence:CCGGGATGACATACTGTGATGCCCACTCGAGTGGGCATCACAGTATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-292s1c1
Sequence:CCGGGTGCCGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010316
GNG3 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-271s1c1
Sequence:CCGGGCTTAAGATTGAGGCCAGCTTCTCGAGAAGCTGGCCTCAATCTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-411s1c1
Sequence:CCGGAGTTCTTCTGTGCGCTCCTCTCTCGAGAGAGGAGCGCACAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-233s1c1
Sequence:CCGGACTATGAGTATTGGTCAAGCACTCGAGTGCTTGACCAATACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-328s1c1
Sequence:CCGGGATGACATACTGTGATGCCCACTCGAGTGGGCATCACAGTATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010316.2-292s1c1
Sequence:CCGGGTGCCGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012202
GNG3 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-288s1c1
Sequence:CCGGACTATGAGTATTGGGCAAGCACTCGAGTGCTTGCCCAATACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-461s1c1
Sequence:CCGGGAAGAAGTTCTTCTGTGCTCTCTCGAGAGAGCACAGAAGAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-338s1c1
Sequence:CCGGAGCCAGCTTGTGTCGGATAAACTCGAGTTTATCCGACACAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-326s1c1
Sequence:CCGGGCTTAAGATTGAAGCCAGCTTCTCGAGAAGCTGGCTTCAATCTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-347s1c1
Sequence:CCGGGTGTCGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012202.3-614s21c1
Sequence:CCGGGCCTGACCATGTGAGGTTATCCTCGAGGATAACCTCACATGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012202.3-710s21c1
Sequence:CCGGAGAGATATGAGGCACCCTTTGCTCGAGCAAAGGGTGCCTCATATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012202.3-393s21c1
Sequence:CCGGGACCTGATGACTTACTGTGATCTCGAGATCACAGTAAGTCATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012202
GNG3 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-288s1c1
Sequence:CCGGACTATGAGTATTGGGCAAGCACTCGAGTGCTTGCCCAATACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-461s1c1
Sequence:CCGGGAAGAAGTTCTTCTGTGCTCTCTCGAGAGAGCACAGAAGAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-338s1c1
Sequence:CCGGAGCCAGCTTGTGTCGGATAAACTCGAGTTTATCCGACACAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-326s1c1
Sequence:CCGGGCTTAAGATTGAAGCCAGCTTCTCGAGAAGCTGGCTTCAATCTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-347s1c1
Sequence:CCGGGTGTCGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012202.3-614s21c1
Sequence:CCGGGCCTGACCATGTGAGGTTATCCTCGAGGATAACCTCACATGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012202.3-710s21c1
Sequence:CCGGAGAGATATGAGGCACCCTTTGCTCGAGCAAAGGGTGCCTCATATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012202.3-393s21c1
Sequence:CCGGGACCTGATGACTTACTGTGATCTCGAGATCACAGTAAGTCATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012202
GNG3 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-288s1c1
Sequence:CCGGACTATGAGTATTGGGCAAGCACTCGAGTGCTTGCCCAATACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-461s1c1
Sequence:CCGGGAAGAAGTTCTTCTGTGCTCTCTCGAGAGAGCACAGAAGAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-338s1c1
Sequence:CCGGAGCCAGCTTGTGTCGGATAAACTCGAGTTTATCCGACACAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-326s1c1
Sequence:CCGGGCTTAAGATTGAAGCCAGCTTCTCGAGAAGCTGGCTTCAATCTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012202.1-347s1c1
Sequence:CCGGGTGTCGGATAAAGGTGTCCAACTCGAGTTGGACACCTTTATCCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012202.3-614s21c1
Sequence:CCGGGCCTGACCATGTGAGGTTATCCTCGAGGATAACCTCACATGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012202.3-710s21c1
Sequence:CCGGAGAGATATGAGGCACCCTTTGCTCGAGCAAAGGGTGCCTCATATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012202.3-393s21c1
Sequence:CCGGGACCTGATGACTTACTGTGATCTCGAGATCACAGTAAGTCATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks