EMAIL THIS PAGE TO A FRIEND

GNG8

guanine nucleotide binding protein (G protein), gamma 8

37 Gene Product Result for
UniProtKB ID: Q9UK08, Q4VBM5
Gene ID:
Mouse(14709) guanine nucleotide binding protein (G protein), gamma 8
Rat(245986) guanine nucleotide binding protein (G protein), gamma 8
sheep(101116593) guanine nucleotide binding protein (G protein), gamma 8
domestic guinea pig(100725986) guanine nucleotide binding protein (G protein), gamma 8
naked mole-rat(101722298) guanine nucleotide binding protein (G protein), gamma 8
Zebrafish(553609) guanine nucleotide binding protein (G protein), gamma 8
dog(484428) guanine nucleotide binding protein (G protein), gamma 8
cow(618470) guanine nucleotide binding protein (G protein), gamma 8
domestic cat(101090817) guanine nucleotide binding protein (G protein), gamma 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033258 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU204231 MISSION® esiRNA esiRNA targeting mouse Gng8 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033258 Rosetta Predictions human pricing
NM_139185 Rosetta Predictions rat pricing
NM_010320 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033842 predicted 107
2 SASI_Hs01_00033843 predicted 92
3 SASI_Hs01_00033844 predicted 104
4 SASI_Hs01_00033845 predicted 30
5 SASI_Hs01_00033846 predicted 79
6 SASI_Hs01_00033847 predicted 57
7 SASI_Hs01_00033848 predicted 148
8 SASI_Hs01_00033849 predicted 144
9 SASI_Hs01_00033850 predicted 29
10 SASI_Hs01_00033851 predicted 175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082377 predicted 277
2 SASI_Rn01_00082378 predicted 282
3 SASI_Rn01_00082379 predicted 314
4 SASI_Rn01_00082380 predicted 250
5 SASI_Rn01_00082381 predicted 301
6 SASI_Rn01_00082382 predicted 315
7 SASI_Rn01_00082383 predicted 322
8 SASI_Rn01_00082384 predicted 267
9 SASI_Rn01_00082385 predicted 320
10 SASI_Rn01_00082386 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107126 predicted 693
2 SASI_Mm01_00107127 predicted 696
3 SASI_Mm01_00107128 predicted 667
4 SASI_Mm01_00107129 predicted 686
5 SASI_Mm01_00107130 predicted 659
6 SASI_Mm01_00107131 predicted 684
7 SASI_Mm01_00107132 predicted 661
8 SASI_Mm01_00107133 predicted 639
9 SASI_Mm01_00107134 predicted 865
10 SASI_Mm01_00107135 predicted 872
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010320
GNG8 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-63s1c1
Sequence:CCGGAGTGAACATCGATCGCATGAACTCGAGTTCATGCGATCGATGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-52s1c1
Sequence:CCGGCTGAAGCTGGAAGTGAACATCCTCGAGGATGTTCACTTCCAGCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-48s1c1
Sequence:CCGGGCAGCTGAAGCTGGAAGTGAACTCGAGTTCACTTCCAGCTTCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-54s1c1
Sequence:CCGGGAAGCTGGAAGTGAACATCGACTCGAGTCGATGTTCACTTCCAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-59s1c1
Sequence:CCGGTGGAAGTGAACATCGATCGCACTCGAGTGCGATCGATGTTCACTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010320
GNG8 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-63s1c1
Sequence:CCGGAGTGAACATCGATCGCATGAACTCGAGTTCATGCGATCGATGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-52s1c1
Sequence:CCGGCTGAAGCTGGAAGTGAACATCCTCGAGGATGTTCACTTCCAGCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-48s1c1
Sequence:CCGGGCAGCTGAAGCTGGAAGTGAACTCGAGTTCACTTCCAGCTTCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-54s1c1
Sequence:CCGGGAAGCTGGAAGTGAACATCGACTCGAGTCGATGTTCACTTCCAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-59s1c1
Sequence:CCGGTGGAAGTGAACATCGATCGCACTCGAGTGCGATCGATGTTCACTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010320
GNG8 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-63s1c1
Sequence:CCGGAGTGAACATCGATCGCATGAACTCGAGTTCATGCGATCGATGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-52s1c1
Sequence:CCGGCTGAAGCTGGAAGTGAACATCCTCGAGGATGTTCACTTCCAGCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-48s1c1
Sequence:CCGGGCAGCTGAAGCTGGAAGTGAACTCGAGTTCACTTCCAGCTTCAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-54s1c1
Sequence:CCGGGAAGCTGGAAGTGAACATCGACTCGAGTCGATGTTCACTTCCAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010320.2-59s1c1
Sequence:CCGGTGGAAGTGAACATCGATCGCACTCGAGTGCGATCGATGTTCACTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033258
GNG8 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-54s1c1
Sequence:CCGGGAAGCTGGAGGTGAACATCGACTCGAGTCGATGTTCACCTCCAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-48s1c1
Sequence:CCGGACAGCTGAAGCTGGAGGTGAACTCGAGTTCACCTCCAGCTTCAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-51s1c1
Sequence:CCGGGCTGAAGCTGGAGGTGAACATCTCGAGATGTTCACCTCCAGCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-62s1c1
Sequence:CCGGAGGTGAACATCGACCGCATGACTCGAGTCATGCGGTCGATGTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-59s1c1
Sequence:CCGGTGGAGGTGAACATCGACCGCACTCGAGTGCGGTCGATGTTCACCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033258.1-105s21c1
Sequence:CCGGACTCCTGGCTTTCTGCGAGACCTCGAGGTCTCGCAGAAAGCCAGGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033258.1-36s21c1
Sequence:CCGGCAAGACGGTGGAACAGCTGAACTCGAGTTCAGCTGTTCCACCGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033258
GNG8 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-54s1c1
Sequence:CCGGGAAGCTGGAGGTGAACATCGACTCGAGTCGATGTTCACCTCCAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-48s1c1
Sequence:CCGGACAGCTGAAGCTGGAGGTGAACTCGAGTTCACCTCCAGCTTCAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-51s1c1
Sequence:CCGGGCTGAAGCTGGAGGTGAACATCTCGAGATGTTCACCTCCAGCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-62s1c1
Sequence:CCGGAGGTGAACATCGACCGCATGACTCGAGTCATGCGGTCGATGTTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-59s1c1
Sequence:CCGGTGGAGGTGAACATCGACCGCACTCGAGTGCGGTCGATGTTCACCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033258.1-105s21c1
Sequence:CCGGACTCCTGGCTTTCTGCGAGACCTCGAGGTCTCGCAGAAAGCCAGGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033258.1-36s21c1
Sequence:CCGGCAAGACGGTGGAACAGCTGAACTCGAGTTCAGCTGTTCCACCGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033258
GNG8 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-54s1c1
Sequence:CCGGGAAGCTGGAGGTGAACATCGACTCGAGTCGATGTTCACCTCCAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-48s1c1
Sequence:CCGGACAGCTGAAGCTGGAGGTGAACTCGAGTTCACCTCCAGCTTCAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-51s1c1
Sequence:CCGGGCTGAAGCTGGAGGTGAACATCTCGAGATGTTCACCTCCAGCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-62s1c1
Sequence:CCGGAGGTGAACATCGACCGCATGACTCGAGTCATGCGGTCGATGTTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033258.1-59s1c1
Sequence:CCGGTGGAGGTGAACATCGACCGCACTCGAGTGCGGTCGATGTTCACCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033258.1-105s21c1
Sequence:CCGGACTCCTGGCTTTCTGCGAGACCTCGAGGTCTCGCAGAAAGCCAGGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033258.1-36s21c1
Sequence:CCGGCAAGACGGTGGAACAGCTGAACTCGAGTTCAGCTGTTCCACCGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)