EMAIL THIS PAGE TO A FRIEND

GNGT1

guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1

53 Gene Product Result for
Synonyms: GNG1
UniProtKB ID: P63211, A4D1H2, O43835, Q08447, Q16026
Gene ID:
Human(2792) Summary: Heterotrimeric guanine nucleotide-binding proteins (G proteins) transduce extracellular signals received by transmembrane receptors to effector proteins. Transducin is a guanine nucleotide-binding protein found specifically in rod outer segments, where it mediates activation by rhodopsin of a cyclic GTP-specific (guanosine monophosphate) phosphodiesterase. Transducin is also referred to as GMPase. GNGT1 encodes the gamma subunit of transducin (Hurley et al., 1984 [PubMed 6438626]
Mouse(14699) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
Rat(680149) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
Zebrafish(335656) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
cow(281796) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
domestic cat(101088476) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
dog(403895) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
domestic guinea pig(100733904) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
naked mole-rat(101720513) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
sheep(101114097) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021955 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021955 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021955 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130351 MISSION® esiRNA esiRNA human GNGT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021955 Rosetta Predictions human pricing
XM_001054602 Rosetta Predictions rat pricing
XM_001054660 Rosetta Predictions rat pricing
NM_010314 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177499 predicted 410
2 SASI_Hs01_00177500 predicted 243
3 SASI_Hs01_00177501 predicted 516
4 SASI_Hs01_00177502 predicted 341
5 SASI_Hs01_00177503 predicted 191
6 SASI_Hs01_00177505 predicted 574
7 SASI_Hs01_00177506 predicted 444
8 SASI_Hs01_00177507 predicted 296
9 SASI_Hs01_00177508 predicted 574
10 SASI_Hs02_00355289 predicted 228
11 SASI_Hs01_00177504 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276420 predicted 201
2 SASI_Rn02_00276421 predicted 201
3 SASI_Rn02_00276422 predicted 200
4 SASI_Rn02_00276423 predicted 197
5 SASI_Rn02_00276424 predicted 218
6 SASI_Rn02_00276425 predicted 210
7 SASI_Rn02_00276426 predicted 202
8 SASI_Rn02_00276427 predicted 196
9 SASI_Rn02_00276428 predicted 97
10 SASI_Rn02_00276429 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276687 predicted 220
2 SASI_Rn02_00276688 predicted 227
3 SASI_Rn02_00276689 predicted 222
4 SASI_Rn02_00276690 predicted 256
5 SASI_Rn02_00276691 predicted 226
6 SASI_Rn02_00276692 predicted 219
7 SASI_Rn02_00276693 predicted 275
8 SASI_Rn02_00276694 predicted 208
9 SASI_Rn02_00276695 predicted 205
10 SASI_Rn02_00276696 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318300 predicted 350
2 SASI_Mm02_00318301 predicted 342
3 SASI_Mm02_00318302 predicted 273
4 SASI_Mm02_00318303 predicted 355
5 SASI_Mm02_00318304 predicted 353
6 SASI_Mm02_00318305 predicted 282
7 SASI_Mm02_00318306 predicted 350
8 SASI_Mm02_00318307 predicted 280
9 SASI_Mm02_00318308 predicted 279
10 SASI_Mm02_00318309 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021955
GNGT1 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021955.3-292s21c1
Sequence:CCGGTGGCGAGGATCCACTGGTAAACTCGAGTTTACCAGTGGATCCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021955.3-449s21c1
Sequence:CCGGATGCATACTATTACTACTAAGCTCGAGCTTAGTAGTAATAGTATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021955.3-229s21c1
Sequence:CCGGACTGGAAAGAATGCTAGTTTCCTCGAGGAAACTAGCATTCTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-237s1c1
Sequence:CCGGGAATGCTAGTTTCCAAATGTTCTCGAGAACATTTGGAAACTAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-352s1c1
Sequence:CCGGAGGAGGCTGTGTGATTTCATACTCGAGTATGAAATCACACAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-266s1c1
Sequence:CCGGGTAAGAGATTACGTTGAAGAACTCGAGTTCTTCAACGTAATCTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-200s1c1
Sequence:CCGGGAAGTTGACCAGCTCAAGAAACTCGAGTTTCTTGAGCTGGTCAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-249s1c1
Sequence:CCGGCCAAATGTTGTGAAGAAGTAACTCGAGTTACTTCTTCACAACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021955
GNGT1 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021955.3-292s21c1
Sequence:CCGGTGGCGAGGATCCACTGGTAAACTCGAGTTTACCAGTGGATCCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021955.3-449s21c1
Sequence:CCGGATGCATACTATTACTACTAAGCTCGAGCTTAGTAGTAATAGTATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021955.3-229s21c1
Sequence:CCGGACTGGAAAGAATGCTAGTTTCCTCGAGGAAACTAGCATTCTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-237s1c1
Sequence:CCGGGAATGCTAGTTTCCAAATGTTCTCGAGAACATTTGGAAACTAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-352s1c1
Sequence:CCGGAGGAGGCTGTGTGATTTCATACTCGAGTATGAAATCACACAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-266s1c1
Sequence:CCGGGTAAGAGATTACGTTGAAGAACTCGAGTTCTTCAACGTAATCTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-200s1c1
Sequence:CCGGGAAGTTGACCAGCTCAAGAAACTCGAGTTTCTTGAGCTGGTCAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-249s1c1
Sequence:CCGGCCAAATGTTGTGAAGAAGTAACTCGAGTTACTTCTTCACAACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021955
GNGT1 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021955.3-292s21c1
Sequence:CCGGTGGCGAGGATCCACTGGTAAACTCGAGTTTACCAGTGGATCCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021955.3-449s21c1
Sequence:CCGGATGCATACTATTACTACTAAGCTCGAGCTTAGTAGTAATAGTATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021955.3-229s21c1
Sequence:CCGGACTGGAAAGAATGCTAGTTTCCTCGAGGAAACTAGCATTCTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-237s1c1
Sequence:CCGGGAATGCTAGTTTCCAAATGTTCTCGAGAACATTTGGAAACTAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-352s1c1
Sequence:CCGGAGGAGGCTGTGTGATTTCATACTCGAGTATGAAATCACACAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-266s1c1
Sequence:CCGGGTAAGAGATTACGTTGAAGAACTCGAGTTCTTCAACGTAATCTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-200s1c1
Sequence:CCGGGAAGTTGACCAGCTCAAGAAACTCGAGTTTCTTGAGCTGGTCAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021955.2-249s1c1
Sequence:CCGGCCAAATGTTGTGAAGAAGTAACTCGAGTTACTTCTTCACAACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010314
GNGT1 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010314.1-503s1c1
Sequence:CCGGCCTGCTTTAGAAGCAGTGTATCTCGAGATACACTGCTTCTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010314.1-130s1c1
Sequence:CCGGAGATGGAGGTAGACCAGCTTACTCGAGTAAGCTGGTCTACCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010314.1-184s1c1
Sequence:CCGGCCAAATGTTGTGAAGAAGTGACTCGAGTCACTTCTTCACAACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010314.1-190s1c1
Sequence:CCGGGTTGTGAAGAAGTGAGAGATTCTCGAGAATCTCTCACTTCTTCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010314.1-168s1c1
Sequence:CCGGGAGAGAATGATGGTTTCCAAACTCGAGTTTGGAAACCATCATTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010314
GNGT1 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010314.1-503s1c1
Sequence:CCGGCCTGCTTTAGAAGCAGTGTATCTCGAGATACACTGCTTCTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010314.1-130s1c1
Sequence:CCGGAGATGGAGGTAGACCAGCTTACTCGAGTAAGCTGGTCTACCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010314.1-184s1c1
Sequence:CCGGCCAAATGTTGTGAAGAAGTGACTCGAGTCACTTCTTCACAACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010314.1-190s1c1
Sequence:CCGGGTTGTGAAGAAGTGAGAGATTCTCGAGAATCTCTCACTTCTTCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010314.1-168s1c1
Sequence:CCGGGAGAGAATGATGGTTTCCAAACTCGAGTTTGGAAACCATCATTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010314
GNGT1 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010314.1-503s1c1
Sequence:CCGGCCTGCTTTAGAAGCAGTGTATCTCGAGATACACTGCTTCTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010314.1-130s1c1
Sequence:CCGGAGATGGAGGTAGACCAGCTTACTCGAGTAAGCTGGTCTACCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010314.1-184s1c1
Sequence:CCGGCCAAATGTTGTGAAGAAGTGACTCGAGTCACTTCTTCACAACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010314.1-190s1c1
Sequence:CCGGGTTGTGAAGAAGTGAGAGATTCTCGAGAATCTCTCACTTCTTCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010314.1-168s1c1
Sequence:CCGGGAGAGAATGATGGTTTCCAAACTCGAGTTTGGAAACCATCATTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks