EMAIL THIS PAGE TO A FRIEND

GNGT2

guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2

60 Gene Product Result for
Synonyms: G-GAMMA-8 G-GAMMA-C GNG8 GNG9 GNGT8
UniProtKB ID: O14610, B2R746, D3DTW5
Gene ID:
Human(2793) Summary: Phototransduction in rod and cone photoreceptors is regulated by groups of signaling proteins. The encoded protein is thought to play a crucial role in cone phototransduction. It belongs to the G protein gamma family and localized specifically in cones. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(14710) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
Rat(690825) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
sheep(101112993) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
domestic guinea pig(100714012) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
naked mole-rat(101721190) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
dog(403617) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
domestic cat(101096184) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
cow(281797) guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023121 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023121 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023121 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031498 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031498 Rosetta Predictions human pricing
XM_001075781 Rosetta Predictions rat pricing
NM_001038664 Rosetta Predictions mouse pricing
NM_023121 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201587 predicted 783
2 SASI_Hs01_00201588 predicted 399
3 SASI_Hs01_00201589 predicted 376
4 SASI_Hs01_00201590 predicted 532
5 SASI_Hs01_00201591 predicted 719
6 SASI_Hs01_00201594 predicted 413
7 SASI_Hs01_00201595 predicted 632
8 SASI_Hs02_00358938 predicted 542
9 SASI_Hs02_00358939 predicted 485
10 SASI_Hs02_00358940 predicted 584
11 SASI_Hs01_00201592 predicted 487
12 SASI_Hs01_00201593 predicted 602
13 SASI_Hs01_00201596 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351011 predicted 94
2 SASI_Rn02_00351012 predicted 43
3 SASI_Rn02_00351013 predicted 174
4 SASI_Rn02_00351014 predicted 63
5 SASI_Rn02_00351015 predicted 92
6 SASI_Rn02_00351016 predicted 81
7 SASI_Rn02_00351017 predicted 93
8 SASI_Rn02_00351018 predicted 107
9 SASI_Rn02_00351019 predicted 27
10 SASI_Rn02_00351020 predicted 40
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104023 predicted 330
2 SASI_Mm01_00104024 predicted 300
3 SASI_Mm01_00104025 predicted 324
4 SASI_Mm01_00104026 predicted 312
5 SASI_Mm01_00104032 predicted 320
6 SASI_Mm01_00104027 predicted 327
7 SASI_Mm01_00104028 predicted 309
8 SASI_Mm02_00289669 predicted 238
9 SASI_Mm01_00104030 predicted 300
10 SASI_Mm01_00104029 predicted 302
11 SASI_Mm01_00104031 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083646 predicted 315
2 SASI_Mm01_00083647 predicted 287
3 SASI_Mm01_00083648 predicted 318
4 SASI_Mm01_00083649 predicted 297
5 SASI_Mm02_00326814 predicted 310
6 SASI_Mm01_00083650 predicted 315
7 SASI_Mm01_00083651 predicted 287
8 SASI_Mm01_00083652 predicted 224
9 SASI_Mm01_00083654 predicted 283
10 SASI_Mm01_00083653 predicted 282
11 SASI_Mm01_00083655 predicted 1365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023121
GNGT2 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1323s1c1
Sequence:CCGGCCCACGTGATCTGATTTCCAACTCGAGTTGGAAATCAGATCACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1363s1c1
Sequence:CCGGGATTATGTAGAGGCCCAAGCACTCGAGTGCTTGGGCCTCTACATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1299s1c1
Sequence:CCGGGCAGCTGAAGAAGGAAGTGAACTCGAGTTCACTTCCTTCTTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1401s1c1
Sequence:CCGGCAAAGGCATCCCAGAAGACAACTCGAGTTGTCTTCTGGGATGCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1427s1c1
Sequence:CCGGCCTTCAAGGAGAAAGGCACTTCTCGAGAAGTGCCTTTCTCCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023121
GNGT2 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1323s1c1
Sequence:CCGGCCCACGTGATCTGATTTCCAACTCGAGTTGGAAATCAGATCACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1363s1c1
Sequence:CCGGGATTATGTAGAGGCCCAAGCACTCGAGTGCTTGGGCCTCTACATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1299s1c1
Sequence:CCGGGCAGCTGAAGAAGGAAGTGAACTCGAGTTCACTTCCTTCTTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1401s1c1
Sequence:CCGGCAAAGGCATCCCAGAAGACAACTCGAGTTGTCTTCTGGGATGCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1427s1c1
Sequence:CCGGCCTTCAAGGAGAAAGGCACTTCTCGAGAAGTGCCTTTCTCCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023121
GNGT2 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1323s1c1
Sequence:CCGGCCCACGTGATCTGATTTCCAACTCGAGTTGGAAATCAGATCACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1363s1c1
Sequence:CCGGGATTATGTAGAGGCCCAAGCACTCGAGTGCTTGGGCCTCTACATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1299s1c1
Sequence:CCGGGCAGCTGAAGAAGGAAGTGAACTCGAGTTCACTTCCTTCTTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1401s1c1
Sequence:CCGGCAAAGGCATCCCAGAAGACAACTCGAGTTGTCTTCTGGGATGCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023121.1-1427s1c1
Sequence:CCGGCCTTCAAGGAGAAAGGCACTTCTCGAGAAGTGCCTTTCTCCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031498
GNGT2 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-387s1c1
Sequence:CCGGTCCGATTTCCAAAGCGGGAAACTCGAGTTTCCCGCTTTGGAAATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-491s1c1
Sequence:CCGGAGAAAGGTGGCTGTCTGATAACTCGAGTTATCAGACAGCCACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-432s1c1
Sequence:CCGGCCAAGCAGGAAACGATCCTTTCTCGAGAAAGGATCGTTTCCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-396s1c1
Sequence:CCGGCAAAGCGGGAAAGGAAATCAACTCGAGTTGATTTCCTTTCCCGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-378s1c1
Sequence:CCGGCACAAGAATTCCGATTTCCAACTCGAGTTGGAAATCGGAATTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031498.2-623s21c1
Sequence:CCGGAGTAAAGATCCCTGAACAAATCTCGAGATTTGTTCAGGGATCTTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031498.2-608s21c1
Sequence:CCCGCTTCATCACAGAATGAGTAAACTCGAGTTTACTCATTCTGTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031498
GNGT2 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-387s1c1
Sequence:CCGGTCCGATTTCCAAAGCGGGAAACTCGAGTTTCCCGCTTTGGAAATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-491s1c1
Sequence:CCGGAGAAAGGTGGCTGTCTGATAACTCGAGTTATCAGACAGCCACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-432s1c1
Sequence:CCGGCCAAGCAGGAAACGATCCTTTCTCGAGAAAGGATCGTTTCCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-396s1c1
Sequence:CCGGCAAAGCGGGAAAGGAAATCAACTCGAGTTGATTTCCTTTCCCGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-378s1c1
Sequence:CCGGCACAAGAATTCCGATTTCCAACTCGAGTTGGAAATCGGAATTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031498.2-623s21c1
Sequence:CCGGAGTAAAGATCCCTGAACAAATCTCGAGATTTGTTCAGGGATCTTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031498.2-608s21c1
Sequence:CCCGCTTCATCACAGAATGAGTAAACTCGAGTTTACTCATTCTGTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031498
GNGT2 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-387s1c1
Sequence:CCGGTCCGATTTCCAAAGCGGGAAACTCGAGTTTCCCGCTTTGGAAATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-491s1c1
Sequence:CCGGAGAAAGGTGGCTGTCTGATAACTCGAGTTATCAGACAGCCACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-432s1c1
Sequence:CCGGCCAAGCAGGAAACGATCCTTTCTCGAGAAAGGATCGTTTCCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-396s1c1
Sequence:CCGGCAAAGCGGGAAAGGAAATCAACTCGAGTTGATTTCCTTTCCCGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031498.1-378s1c1
Sequence:CCGGCACAAGAATTCCGATTTCCAACTCGAGTTGGAAATCGGAATTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031498.2-623s21c1
Sequence:CCGGAGTAAAGATCCCTGAACAAATCTCGAGATTTGTTCAGGGATCTTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031498.2-608s21c1
Sequence:CCCGCTTCATCACAGAATGAGTAAACTCGAGTTTACTCATTCTGTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks