EMAIL THIS PAGE TO A FRIEND

GNL1

guanine nucleotide binding protein-like 1

82 Gene Product Result for
Synonyms: HSR1
UniProtKB ID: P36915, B0S838, Q96CT5
Gene ID:
Human(2794) Summary: The GNL1 gene, identified in the human major histocompatibility complex class I region, shows a high degree of similarity with its mouse counterpart. The GNL1 gene is located less than 2 kb centromeric to HLA-E, in the same transcriptional orientation. GNL1 is telomeric to HLA-B and HLA-C. [provided by RefSeq, Jul 2008]
Mouse(14670) guanine nucleotide binding protein-like 1
Rat(309593) guanine nucleotide binding protein-like 1
sheep(101107395) guanine nucleotide binding protein-like 1
domestic guinea pig(100721188) guanine nucleotide binding protein-like 1
naked mole-rat(101711398) guanine nucleotide binding protein-like 1
Zebrafish(568505) guanine nucleotide binding protein-like 1
Thale Cress(833946) ARF guanine-nucleotide exchange factor GNL1
dog(474825) guanine nucleotide binding protein-like 1
domestic cat(101091787) guanine nucleotide binding protein-like 1
cow(532528) guanine nucleotide binding protein-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005275 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005275 Rosetta Predictions human pricing
NM_212500 Rosetta Predictions rat pricing
NM_008136 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054452 predicted 1566
2 SASI_Hs01_00054453 predicted 1950
3 SASI_Hs01_00054454 predicted 1601
4 SASI_Hs02_00339327 predicted 2202
5 SASI_Hs01_00054455 predicted 1592
6 SASI_Hs01_00054456 predicted 2346
7 SASI_Hs01_00054457 predicted 2137
8 SASI_Hs01_00054458 predicted 1641
9 SASI_Hs01_00054459 predicted 1817
10 SASI_Hs01_00054461 predicted 1617
11 SASI_Hs01_00054460 predicted 2114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065400 predicted 519
2 SASI_Rn01_00065401 predicted 531
3 SASI_Rn01_00065402 predicted 1349
4 SASI_Rn01_00065404 predicted 1212
5 SASI_Rn01_00065405 predicted 775
6 SASI_Rn01_00065406 predicted 437
7 SASI_Rn01_00065407 predicted 433
8 SASI_Rn02_00270482 predicted 1623
9 SASI_Rn01_00065408 predicted 1208
10 SASI_Rn02_00270483 predicted 198
11 SASI_Rn01_00065403 predicted 1064
12 SASI_Rn01_00065409 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168328 predicted 960
2 SASI_Mm02_00313212 predicted 1988
3 SASI_Mm02_00313213 predicted 1765
4 SASI_Mm02_00313214 predicted 2271
5 SASI_Mm01_00168335 predicted 1052
6 SASI_Mm02_00313215 predicted 1709
7 SASI_Mm02_00313216 predicted 2125
8 SASI_Mm01_00168336 predicted 791
9 SASI_Mm02_00313217 predicted 2272
10 SASI_Mm02_00313218 predicted 1293
11 SASI_Mm01_00168329 predicted 482
12 SASI_Mm01_00168330 predicted 403
13 SASI_Mm01_00168331 predicted 423
14 SASI_Mm01_00168332 predicted 412
15 SASI_Mm01_00168333 predicted 477
16 SASI_Mm01_00168334 predicted 488
17 SASI_Mm01_00168337 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008136
VALIDATED
GNL1 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein-like 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008136.2-839s21c1
Sequence:CCGGGCACTTTACGAGTATGTAACTCTCGAGAGTTACATACTCGTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008136.2-2463s1c1
Sequence:CCGGCTAGACTCAGTGAACATTTATCTCGAGATAAATGTTCACTGAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008136.2-1760s21c1
Sequence:CCGGCTCAGCCTATGTTTCTACCCTCTCGAGAGGGTAGAAACATAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008136.2-2316s21c1
Sequence:CCGGTGGCAGGCTCACCTGGTATTACTCGAGTAATACCAGGTGAGCCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008136.2-379s21c1
Sequence:CCGGGGAATCCGTGACCCATCATATCTCGAGATATGATGGGTCACGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008136.2-1710s21c1
Sequence:CCGGACGTGTACAGAGCGGCCAATACTCGAGTATTGGCCGCTCTGTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008136.1-1402s1c1
Sequence:CCGGCTCAGCCTATGTTTCTACCCTCTCGAGAGGGTAGAAACATAGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008136.1-478s1c1
Sequence:CCGGCCAGCACTTTACGAGTATGTACTCGAGTACATACTCGTAAAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008136.1-481s1c1
Sequence:CCGGGCACTTTACGAGTATGTAACTCTCGAGAGTTACATACTCGTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008136.1-490s1c1
Sequence:CCGGGAGTATGTAACTGGAGAGCTTCTCGAGAAGCTCTCCAGTTACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008136.1-489s1c1
Sequence:CCGGCGAGTATGTAACTGGAGAGCTCTCGAGAGCTCTCCAGTTACATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008136.1-565s1c1
Sequence:CCGGGTGGTTGCCTGGAAGCATTATCTCGAGATAATGCTTCCAGGCAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008136
VALIDATED
GNL1 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein-like 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008136.2-839s21c1
Sequence:CCGGGCACTTTACGAGTATGTAACTCTCGAGAGTTACATACTCGTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008136.2-2463s1c1
Sequence:CCGGCTAGACTCAGTGAACATTTATCTCGAGATAAATGTTCACTGAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008136.2-1760s21c1
Sequence:CCGGCTCAGCCTATGTTTCTACCCTCTCGAGAGGGTAGAAACATAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008136.2-2316s21c1
Sequence:CCGGTGGCAGGCTCACCTGGTATTACTCGAGTAATACCAGGTGAGCCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008136.2-379s21c1
Sequence:CCGGGGAATCCGTGACCCATCATATCTCGAGATATGATGGGTCACGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008136.2-1710s21c1
Sequence:CCGGACGTGTACAGAGCGGCCAATACTCGAGTATTGGCCGCTCTGTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008136.1-1402s1c1
Sequence:CCGGCTCAGCCTATGTTTCTACCCTCTCGAGAGGGTAGAAACATAGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008136.1-478s1c1
Sequence:CCGGCCAGCACTTTACGAGTATGTACTCGAGTACATACTCGTAAAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008136.1-481s1c1
Sequence:CCGGGCACTTTACGAGTATGTAACTCTCGAGAGTTACATACTCGTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008136.1-490s1c1
Sequence:CCGGGAGTATGTAACTGGAGAGCTTCTCGAGAAGCTCTCCAGTTACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008136.1-489s1c1
Sequence:CCGGCGAGTATGTAACTGGAGAGCTCTCGAGAGCTCTCCAGTTACATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008136.1-565s1c1
Sequence:CCGGGTGGTTGCCTGGAAGCATTATCTCGAGATAATGCTTCCAGGCAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008136
VALIDATED
GNL1 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein-like 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008136.2-839s21c1
Sequence:CCGGGCACTTTACGAGTATGTAACTCTCGAGAGTTACATACTCGTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008136.2-2463s1c1
Sequence:CCGGCTAGACTCAGTGAACATTTATCTCGAGATAAATGTTCACTGAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008136.2-1760s21c1
Sequence:CCGGCTCAGCCTATGTTTCTACCCTCTCGAGAGGGTAGAAACATAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008136.2-2316s21c1
Sequence:CCGGTGGCAGGCTCACCTGGTATTACTCGAGTAATACCAGGTGAGCCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008136.2-379s21c1
Sequence:CCGGGGAATCCGTGACCCATCATATCTCGAGATATGATGGGTCACGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008136.2-1710s21c1
Sequence:CCGGACGTGTACAGAGCGGCCAATACTCGAGTATTGGCCGCTCTGTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008136.1-1402s1c1
Sequence:CCGGCTCAGCCTATGTTTCTACCCTCTCGAGAGGGTAGAAACATAGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008136.1-478s1c1
Sequence:CCGGCCAGCACTTTACGAGTATGTACTCGAGTACATACTCGTAAAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008136.1-481s1c1
Sequence:CCGGGCACTTTACGAGTATGTAACTCTCGAGAGTTACATACTCGTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008136.1-490s1c1
Sequence:CCGGGAGTATGTAACTGGAGAGCTTCTCGAGAAGCTCTCCAGTTACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008136.1-489s1c1
Sequence:CCGGCGAGTATGTAACTGGAGAGCTCTCGAGAGCTCTCCAGTTACATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008136.1-565s1c1
Sequence:CCGGGTGGTTGCCTGGAAGCATTATCTCGAGATAATGCTTCCAGGCAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005275
VALIDATED
GNL1 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-1260s1c1
Sequence:CCGGCCAAATCGATACCGACTGCATCTCGAGATGCAGTCGGTATCGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005275.2-2508s1c1
Sequence:CCGGGCTCGGAATGATGTGTACAGACTCGAGTCTGTACACATCATTCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-1484s1c1
Sequence:CCGGCCAAGACTATCTTGGGAAGATCTCGAGATCTTCCCAAGATAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005275.2-1058s1c1
Sequence:CCGGGCAGAAGAAGAAGCAGTTGCACTCGAGTGCAACTGCTTCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-2212s1c1
Sequence:CCGGCCCGATACTTTCAGACCTACTCTCGAGAGTAGGTCTGAAAGTATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-1598s1c1
Sequence:CCGGCGTCCTGCTTATCACTGATATCTCGAGATATCAGTGATAAGCAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-2214s1c2
Sequence:CCGGCGATACTTTCAGACCTACTTTCTCGAGAAAGTAGGTCTGAAAGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005275
VALIDATED
GNL1 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-1260s1c1
Sequence:CCGGCCAAATCGATACCGACTGCATCTCGAGATGCAGTCGGTATCGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005275.2-2508s1c1
Sequence:CCGGGCTCGGAATGATGTGTACAGACTCGAGTCTGTACACATCATTCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-1484s1c1
Sequence:CCGGCCAAGACTATCTTGGGAAGATCTCGAGATCTTCCCAAGATAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005275.2-1058s1c1
Sequence:CCGGGCAGAAGAAGAAGCAGTTGCACTCGAGTGCAACTGCTTCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-2212s1c1
Sequence:CCGGCCCGATACTTTCAGACCTACTCTCGAGAGTAGGTCTGAAAGTATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-1598s1c1
Sequence:CCGGCGTCCTGCTTATCACTGATATCTCGAGATATCAGTGATAAGCAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-2214s1c2
Sequence:CCGGCGATACTTTCAGACCTACTTTCTCGAGAAAGTAGGTCTGAAAGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005275
VALIDATED
GNL1 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-1260s1c1
Sequence:CCGGCCAAATCGATACCGACTGCATCTCGAGATGCAGTCGGTATCGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005275.2-2508s1c1
Sequence:CCGGGCTCGGAATGATGTGTACAGACTCGAGTCTGTACACATCATTCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-1484s1c1
Sequence:CCGGCCAAGACTATCTTGGGAAGATCTCGAGATCTTCCCAAGATAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005275.2-1058s1c1
Sequence:CCGGGCAGAAGAAGAAGCAGTTGCACTCGAGTGCAACTGCTTCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-2212s1c1
Sequence:CCGGCCCGATACTTTCAGACCTACTCTCGAGAGTAGGTCTGAAAGTATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-1598s1c1
Sequence:CCGGCGTCCTGCTTATCACTGATATCTCGAGATATCAGTGATAAGCAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005275.2-2214s1c2
Sequence:CCGGCGATACTTTCAGACCTACTTTCTCGAGAAAGTAGGTCTGAAAGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks