EMAIL THIS PAGE TO A FRIEND

GNL2

guanine nucleotide binding protein-like 2 (nucleolar)

50 Gene Product Result for
Synonyms: HUMAUANTIG NGP1 Ngp-1
UniProtKB ID: Q13823, Q9BWN7
Gene ID:
Mouse(230737) guanine nucleotide binding protein-like 2 (nucleolar)
Rat(362593) guanine nucleotide binding protein-like 2 (nucleolar)
Zebrafish(793727) guanine nucleotide binding protein-like 2 (nucleolar)
domestic cat(101090786) guanine nucleotide binding protein-like 2 (nucleolar)
cow(507369) guanine nucleotide binding protein-like 2 (nucleolar)
Horse(100054791) guanine nucleotide binding protein-like 2 (nucleolar)
dog(475329) guanine nucleotide binding protein-like 2 (nucleolar)
Thale Cress(832081) ARF guanine-nucleotide exchange factor GNL2
chicken(419614) guanine nucleotide binding protein-like 2 (nucleolar)
domestic guinea pig(100729090) guanine nucleotide binding protein-like 2 (nucleolar)
naked mole-rat(101698867) guanine nucleotide binding protein-like 2 (nucleolar)
sheep(101114824) guanine nucleotide binding protein-like 2 (nucleolar)
Domestic Rabbit(100354071) guanine nucleotide binding protein-like 2 (nucleolar)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145552 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145552 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145552 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013285 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013285 Rosetta Predictions human pricing
NM_001025736 Rosetta Predictions rat pricing
NM_145552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071233 predicted 296
2 SASI_Hs01_00071234 predicted 436
3 SASI_Hs01_00071235 predicted 527
4 SASI_Hs01_00071236 predicted 754
5 SASI_Hs01_00071238 predicted 925
6 SASI_Hs01_00071240 predicted 1250
7 SASI_Hs01_00071241 predicted 1135
8 SASI_Hs01_00071242 predicted 1106
9 SASI_Hs02_00344558 predicted 499
10 SASI_Hs02_00344559 predicted 719
11 SASI_Hs01_00071237 predicted 557
12 SASI_Hs01_00071239 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071719 predicted 217
2 SASI_Rn01_00071720 predicted 1086
3 SASI_Rn01_00071721 predicted 1084
4 SASI_Rn01_00071722 predicted 445
5 SASI_Rn01_00071723 predicted 1300
6 SASI_Rn01_00071724 predicted 985
7 SASI_Rn01_00071725 predicted 1537
8 SASI_Rn01_00071728 predicted 1238
9 SASI_Rn02_00203374 predicted 716
10 SASI_Rn02_00203375 predicted 401
11 SASI_Rn01_00071726 predicted 1291
12 SASI_Rn01_00071727 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122735 predicted 251
2 SASI_Mm01_00122736 predicted 1583
3 SASI_Mm01_00122737 predicted 1521
4 SASI_Mm01_00122738 predicted 195
5 SASI_Mm02_00341041 predicted 408
6 SASI_Mm01_00122739 predicted 1019
7 SASI_Mm01_00122740 predicted 1115
8 SASI_Mm01_00122741 predicted 1905
9 SASI_Mm01_00122742 predicted 451
10 SASI_Mm01_00122743 predicted 342
11 SASI_Mm01_00122744 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145552
GNL2 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein-like 2 (nucleolar)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-1525s1c1
Sequence:CCGGCCATTGGAAGTTCCCACAGAACTCGAGTTCTGTGGGAACTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-1526s1c1
Sequence:CCGGCATTGGAAGTTCCCACAGAAACTCGAGTTTCTGTGGGAACTTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-211s1c1
Sequence:CCGGCGCCTGAATATGTACAGGCAACTCGAGTTGCCTGTACATATTCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-562s1c1
Sequence:CCGGGCAAGTGATATGCAATCCCTTCTCGAGAAGGGATTGCATATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-1956s1c1
Sequence:CCGGCGTCAGAATATCCAAGGACTTCTCGAGAAGTCCTTGGATATTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145552.1-211s21c1
Sequence:CCGGCGCCTGAATATGTACAGGCAACTCGAGTTGCCTGTACATATTCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145552.1-1956s21c1
Sequence:CCGGCGTCAGAATATCCAAGGACTTCTCGAGAAGTCCTTGGATATTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145552.1-1526s21c1
Sequence:CCGGCATTGGAAGTTCCCACAGAAACTCGAGTTTCTGTGGGAACTTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145552.1-562s21c1
Sequence:CCGGGCAAGTGATATGCAATCCCTTCTCGAGAAGGGATTGCATATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145552
GNL2 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein-like 2 (nucleolar)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-1525s1c1
Sequence:CCGGCCATTGGAAGTTCCCACAGAACTCGAGTTCTGTGGGAACTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-1526s1c1
Sequence:CCGGCATTGGAAGTTCCCACAGAAACTCGAGTTTCTGTGGGAACTTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-211s1c1
Sequence:CCGGCGCCTGAATATGTACAGGCAACTCGAGTTGCCTGTACATATTCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-562s1c1
Sequence:CCGGGCAAGTGATATGCAATCCCTTCTCGAGAAGGGATTGCATATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-1956s1c1
Sequence:CCGGCGTCAGAATATCCAAGGACTTCTCGAGAAGTCCTTGGATATTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145552.1-211s21c1
Sequence:CCGGCGCCTGAATATGTACAGGCAACTCGAGTTGCCTGTACATATTCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145552.1-1956s21c1
Sequence:CCGGCGTCAGAATATCCAAGGACTTCTCGAGAAGTCCTTGGATATTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145552.1-1526s21c1
Sequence:CCGGCATTGGAAGTTCCCACAGAAACTCGAGTTTCTGTGGGAACTTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145552.1-562s21c1
Sequence:CCGGGCAAGTGATATGCAATCCCTTCTCGAGAAGGGATTGCATATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145552
GNL2 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein-like 2 (nucleolar)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-1525s1c1
Sequence:CCGGCCATTGGAAGTTCCCACAGAACTCGAGTTCTGTGGGAACTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-1526s1c1
Sequence:CCGGCATTGGAAGTTCCCACAGAAACTCGAGTTTCTGTGGGAACTTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-211s1c1
Sequence:CCGGCGCCTGAATATGTACAGGCAACTCGAGTTGCCTGTACATATTCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-562s1c1
Sequence:CCGGGCAAGTGATATGCAATCCCTTCTCGAGAAGGGATTGCATATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145552.1-1956s1c1
Sequence:CCGGCGTCAGAATATCCAAGGACTTCTCGAGAAGTCCTTGGATATTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145552.1-211s21c1
Sequence:CCGGCGCCTGAATATGTACAGGCAACTCGAGTTGCCTGTACATATTCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145552.1-1956s21c1
Sequence:CCGGCGTCAGAATATCCAAGGACTTCTCGAGAAGTCCTTGGATATTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145552.1-1526s21c1
Sequence:CCGGCATTGGAAGTTCCCACAGAAACTCGAGTTTCTGTGGGAACTTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145552.1-562s21c1
Sequence:CCGGGCAAGTGATATGCAATCCCTTCTCGAGAAGGGATTGCATATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013285
VALIDATED
GNL2 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein-like 2 (nucleolar)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013285.1-1862s1c1
Sequence:CCGGGCCGTTATTAAAGCACTGGATCTCGAGATCCAGTGCTTTAATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013285.1-198s1c1
Sequence:CCGGGCCTGAATATGTATAGGCAAACTCGAGTTTGCCTATACATATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013285.1-1406s1c1
Sequence:CCGGGTGGGTAAGATGGTCCTCAATCTCGAGATTGAGGACCATCTTACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013285.1-536s1c1
Sequence:CCGGCCAAACTTATTTGCAAGTGATCTCGAGATCACTTGCAAATAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_013285.1-609s1c1
Sequence:CCGGGCAAGGATCGTGATTTGGTAACTCGAGTTACCAAATCACGATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-1946s21c1
Sequence:CCGGGCCGTTATTAAAGCACTGGATCTCGAGATCCAGTGCTTTAATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-693s21c1
Sequence:CCGGGCAAGGATCGTGATTTGGTAACTCGAGTTACCAAATCACGATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-2159s21c1
Sequence:CCGGGAACAGGAACATTCAAATAAACTCGAGTTTATTTGAATGTTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-1047s21c1
Sequence:CCGGTTCAGCTTCTGCGGCAGTTTGCTCGAGCAAACTGCCGCAGAAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-1004s21c1
Sequence:CCGGTTCCATGCAAGCCTTACTAACCTCGAGGTTAGTAAGGCTTGCATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013285
VALIDATED
GNL2 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein-like 2 (nucleolar)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013285.1-1862s1c1
Sequence:CCGGGCCGTTATTAAAGCACTGGATCTCGAGATCCAGTGCTTTAATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013285.1-198s1c1
Sequence:CCGGGCCTGAATATGTATAGGCAAACTCGAGTTTGCCTATACATATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013285.1-1406s1c1
Sequence:CCGGGTGGGTAAGATGGTCCTCAATCTCGAGATTGAGGACCATCTTACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013285.1-536s1c1
Sequence:CCGGCCAAACTTATTTGCAAGTGATCTCGAGATCACTTGCAAATAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_013285.1-609s1c1
Sequence:CCGGGCAAGGATCGTGATTTGGTAACTCGAGTTACCAAATCACGATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-1946s21c1
Sequence:CCGGGCCGTTATTAAAGCACTGGATCTCGAGATCCAGTGCTTTAATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-693s21c1
Sequence:CCGGGCAAGGATCGTGATTTGGTAACTCGAGTTACCAAATCACGATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-2159s21c1
Sequence:CCGGGAACAGGAACATTCAAATAAACTCGAGTTTATTTGAATGTTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-1047s21c1
Sequence:CCGGTTCAGCTTCTGCGGCAGTTTGCTCGAGCAAACTGCCGCAGAAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-1004s21c1
Sequence:CCGGTTCCATGCAAGCCTTACTAACCTCGAGGTTAGTAAGGCTTGCATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013285
VALIDATED
GNL2 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein-like 2 (nucleolar)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013285.1-1862s1c1
Sequence:CCGGGCCGTTATTAAAGCACTGGATCTCGAGATCCAGTGCTTTAATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013285.1-198s1c1
Sequence:CCGGGCCTGAATATGTATAGGCAAACTCGAGTTTGCCTATACATATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013285.1-1406s1c1
Sequence:CCGGGTGGGTAAGATGGTCCTCAATCTCGAGATTGAGGACCATCTTACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013285.1-536s1c1
Sequence:CCGGCCAAACTTATTTGCAAGTGATCTCGAGATCACTTGCAAATAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_013285.1-609s1c1
Sequence:CCGGGCAAGGATCGTGATTTGGTAACTCGAGTTACCAAATCACGATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-1946s21c1
Sequence:CCGGGCCGTTATTAAAGCACTGGATCTCGAGATCCAGTGCTTTAATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-693s21c1
Sequence:CCGGGCAAGGATCGTGATTTGGTAACTCGAGTTACCAAATCACGATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-2159s21c1
Sequence:CCGGGAACAGGAACATTCAAATAAACTCGAGTTTATTTGAATGTTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-1047s21c1
Sequence:CCGGTTCAGCTTCTGCGGCAGTTTGCTCGAGCAAACTGCCGCAGAAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013285.2-1004s21c1
Sequence:CCGGTTCCATGCAAGCCTTACTAACCTCGAGGTTAGTAAGGCTTGCATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks